Regulon of Zur in Tolumonas auensis DSM 9187

Properties
Regulator type:	Transcription factor
TF locus tag:	Tola_2912
Regulator family:	FUR
Regulation mode:	repressor
Biological process:	Zinc homeostasis
Effector:	Zinc ion, (Zn2+)
Regulog:	Zur - Psychromonadaceae/Aeromonadales
Statistics of regulated genes:
- Genes	4
- Operons	2
Visualization:
	Allows to visualize regulon content in the context of metabolic pathways

Built upon 19 sites [see more]

Member of regulog collections

By taxonomy - Psychromonadaceae/Aeromonadales
By trascription factor - Zur
By TF family - FUR
By effector - Zinc ion, (Zn2+)
By pathway - Zinc homeostasis

Regulated operons
	Locus Tag	Name	Function
Position: -43 Score: 6.1 Sequence: AATATGTTACGTTATAACATATC Locus tag: Tola_0309 Name: rpmJ Funciton: 50S ribosomal protein L36
	Tola_0309	rpmJ	50S ribosomal protein L36
Position: -185 Score: 5.7 Sequence: CGGGTGTTATGTTATAACATCCG Locus tag: Tola_2913 Name: znuC Funciton: Zinc ABC transporter, ATP-binding protein ZnuC Locus tag: Tola_2914 Name: znuB Funciton: Zinc ABC transporter, inner membrane permease protein ZnuB Locus tag: Tola_2915 Name: znuA Funciton: Zinc ABC transporter, periplasmic-binding protein ZnuA
	Tola_2913	znuC	Zinc ABC transporter, ATP-binding protein ZnuC
	Tola_2914	znuB	Zinc ABC transporter, inner membrane permease protein ZnuB
	Tola_2915	znuA	Zinc ABC transporter, periplasmic-binding protein ZnuA

Export
	Regulated Genes	[ Tab delimited format ]	DOWNLOAD
	Regulatory Sites	[ FASTA format ]	DOWNLOAD