Regulon of Zur in Aeromonas salmonicida subsp. salmonicida A449

Properties
Regulator type:	Transcription factor
TF locus tag:	ASA_3640
Regulator family:	FUR
Regulation mode:	repressor
Biological process:	Zinc homeostasis
Effector:	Zinc ion, (Zn2+)
Regulog:	Zur - Psychromonadaceae/Aeromonadales
Statistics of regulated genes:
- Genes	4
- Operons	3
Visualization:
	Allows to visualize regulon content in the context of metabolic pathways

Built upon 19 sites [see more]

Member of regulog collections

By taxonomy - Psychromonadaceae/Aeromonadales
By trascription factor - Zur
By TF family - FUR
By effector - Zinc ion, (Zn2+)
By pathway - Zinc homeostasis

Regulated operons
	Locus Tag	Name	Function
Position: -42 Score: 6.4 Sequence: TAATTGTTATAAGATAACATATC Locus tag: ASA_2374 Name: rpmE Funciton: LSU ribosomal protein L31p Locus tag: ASA_2375 Name: rpmJ Funciton: 50S ribosomal protein L36
	ASA_2374	rpmE	LSU ribosomal protein L31p
	ASA_2375	rpmJ	50S ribosomal protein L36
Position: 26 Score: 6.2 Sequence: TGAGAGTTATAATATAACAGCAG Locus tag: ASA_0558 Name: znuA Funciton: Zinc ABC transporter, periplasmic-binding protein ZnuA
	ASA_0558	znuA	Zinc ABC transporter, periplasmic-binding protein ZnuA
Position: -74 Score: 6.5 Sequence: AGTGTGTGATAATATAACAAACC Locus tag: ASA_0557 Name: znuC Funciton: Zinc ABC transporter, ATP-binding protein ZnuC
	ASA_0557	znuC	Zinc ABC transporter, ATP-binding protein ZnuC

Export
	Regulated Genes	[ Tab delimited format ]	DOWNLOAD
	Regulatory Sites	[ FASTA format ]	DOWNLOAD