Regulon of Zur in Psychromonas ingrahamii 37

Properties
Regulator type:	Transcription factor
TF locus tag:	Ping_3179
Regulator family:	FUR
Regulation mode:	repressor
Biological process:	Zinc homeostasis
Effector:	Zinc ion, (Zn2+)
Regulog:	Zur - Psychromonadaceae/Aeromonadales
Statistics of regulated genes:
- Genes	1
- Operons	1
Visualization:
	Allows to visualize regulon content in the context of metabolic pathways

Built upon 19 sites [see more]

Member of regulog collections

By taxonomy - Psychromonadaceae/Aeromonadales
By trascription factor - Zur
By TF family - FUR
By effector - Zinc ion, (Zn2+)
By pathway - Zinc homeostasis

Regulated operons
	Locus Tag	Name	Function
Position: -91 Score: 6 Sequence: TAAGTGTTATATTATAACACTTA Position: -52 Score: 6.6 Sequence: TAAGTGTTATAATATAACAAAAT Locus tag: Ping_3634 Name: zip Funciton: Predicted zinc transporter, ZIP family
	Ping_3634	zip	Predicted zinc transporter, ZIP family

Export
	Regulated Genes	[ Tab delimited format ]	DOWNLOAD
	Regulatory Sites	[ FASTA format ]	DOWNLOAD