Regulon of SahR in Reinekea sp. MED297

Properties
Regulator type:	Transcription factor
TF locus tag:	MED297_05504
Regulator family:	ArsR
Regulation mode:	repressor
Biological process:	Methionine metabolism
Effector:	S-adenosylhomocysteine
Regulog:	SahR - Oceanospirillales/Alteromonadales
Statistics of regulated genes:
- Genes	2
- Operons	2
Visualization:
	Allows to visualize regulon content in the context of metabolic pathways

Built upon 15 sites [see more]

Member of regulog collections

By taxonomy - Oceanospirillales/Alteromonadales
By trascription factor - SahR/SamR
By TF family - ArsR
By effector - S-adenosylhomocysteine
By pathway - Methionine metabolism

Regulated operons
	Locus Tag	Name	Function
Position: -87 Score: 7 Sequence: ATATCAAAATATTTTGATAT Locus tag: MED297_01810 Name: metH Funciton: 5-methyltetrahydrofolate--homocysteine methyltransferase (EC 2.1.1.13)
	MED297_01810	metH	5-methyltetrahydrofolate--homocysteine methyltransferase (EC 2.1.1.13)
Position: -61 Score: 7 Sequence: ATATCAAAATATTTTGATAT Locus tag: MED297_05504 Name: sahR Funciton: Transcriptional regulator of methionine metabolism, ArsR family
	MED297_05504	sahR	Transcriptional regulator of methionine metabolism, ArsR family

Export
	Regulated Genes	[ Tab delimited format ]	DOWNLOAD
	Regulatory Sites	[ FASTA format ]	DOWNLOAD