Regulon of NrtR in Delftia acidovorans SPH-1

Properties
Regulator type:	Transcription factor
TF locus tag:	Daci_5757
Regulator family:	NrtR
Regulation mode:	repressor
Biological process:	NAD biosynthesis
Effector:	Adenosine diphosphate ribose
Regulog:	NrtR - Comamonadaceae
Statistics of regulated genes:
- Genes	3
- Operons	2
Visualization:
	Allows to visualize regulon content in the context of metabolic pathways

Built upon 12 sites [see more]

Member of regulog collections

By taxonomy - Comamonadaceae
By trascription factor - NrtR
By TF family - NrtR
By effector - Adenosine diphosphate ribose
By pathway - NAD biosynthesis

Regulated operons
	Locus Tag	Name	Function
Position: -58 Score: 5.8 Sequence: TAAGTTGCACTATGCAACCCA Position: -35 Score: 6 Sequence: CGAGTTGTACAGAACAACTTA Locus tag: Daci_5758 Name: nrtX Funciton: NrtR-regulated hypothetical OrfX, Band 7 protein domain Locus tag: Daci_5759 Name: nrtY Funciton: NrtR-regulated hypothetical OrfY, PpnK-type ATP-NAD kinase domain
	Daci_5758	nrtX	NrtR-regulated hypothetical OrfX, Band 7 protein domain
	Daci_5759	nrtY	NrtR-regulated hypothetical OrfY, PpnK-type ATP-NAD kinase domain
Position: -74 Score: 5.7 Sequence: TAAGTTGTTCTGTACAACTCG Position: -51 Score: 6 Sequence: TGGGTTGCATAGTGCAACTTA Locus tag: Daci_5757 Name: nrtR Funciton: Nudix-like transcriptional regulator NrtR
	Daci_5757	nrtR	Nudix-like transcriptional regulator NrtR

Export
	Regulated Genes	[ Tab delimited format ]	DOWNLOAD
	Regulatory Sites	[ FASTA format ]	DOWNLOAD