Regulon of NrtR in Acinetobacter sp. ADP1

Properties
Regulator type:	Transcription factor
TF locus tag:	ACIAD0962
Regulator family:	NrtR
Regulation mode:	repressor
Biological process:	NAD biosynthesis
Effector:	Adenosine diphosphate ribose
Regulog:	NrtR - Moraxellaceae
Statistics of regulated genes:
- Genes	3
- Operons	1
Visualization:
	Allows to visualize regulon content in the context of metabolic pathways

Built upon 3 sites [see more]

Member of regulog collections

By taxonomy - Moraxellaceae
By trascription factor - NrtR
By TF family - NrtR
By effector - Adenosine diphosphate ribose
By pathway - NAD biosynthesis

Regulated operons
	Locus Tag	Name	Function
Position: -60 Score: 6.2 Sequence: AAATTGTCTTTATGCCACTAT Position: -35 Score: 5.3 Sequence: TTAATGGCTTTATGCCACTAT Locus tag: ACIAD0964 Name: prs Funciton: Ribose-phosphate pyrophosphokinase (EC 2.7.6.1) Locus tag: ACIAD0963 Name: nadV Funciton: Nicotinamide phosphoribosyltransferase (EC 2.4.2.12) Locus tag: ACIAD0962 Name: nrtR Funciton: Nudix-related transcriptional regulator NrtR
	ACIAD0964	prs	Ribose-phosphate pyrophosphokinase (EC 2.7.6.1)
	ACIAD0963	nadV	Nicotinamide phosphoribosyltransferase (EC 2.4.2.12)
	ACIAD0962	nrtR	Nudix-related transcriptional regulator NrtR

Export
	Regulated Genes	[ Tab delimited format ]	DOWNLOAD
	Regulatory Sites	[ FASTA format ]	DOWNLOAD