Regulog NrtR - Moraxellaceae
| Regulator type: | Transcription factor |
| Regulator family: | NrtR |
| Regulation mode: | repressor |
| Biological process: | NAD biosynthesis |
| Effector: | Adenosine diphosphate ribose |
| Phylum: | Proteobacteria/gamma |
| Visualization: | |
|
Allows to visualize regulog content in the context of metabolic pathways |
Member of regulog collections
- By taxonomy - Moraxellaceae
- By trascription factor - NrtR
- By TF family - NrtR
- By effector - Adenosine diphosphate ribose
- By pathway - NAD biosynthesis
| Genome | Genes | Operons |
|---|---|---|
| Acinetobacter sp. ADP1 | 3 | 1 |
| Acinetobacter baumannii AB0057 | 3 | 1 |
| Psychrobacter arcticum 273-4 | ||
| Psychrobacter sp. PRwf-1 |
| Genes | Function | ||||
|---|---|---|---|---|---|
| CRON 1. | |||||
| prs |
*
Acinetobacter sp. ADP1 Site: position = -60 score = 6.19499 sequence = AAATTGTCTTTATGCCACTAT Site: position = -35 score = 5.30124 sequence = TTAATGGCTTTATGCCACTAT Gene: ACIAD0964: Ribose-phosphate pyrophosphokinase (EC 2.7.6.1) |
*
Acinetobacter baumannii AB0057 Site: position = -58 score = 5.84187 sequence = ATAGTGGCTTTGTGCCACTAT Gene: AB57_2115: Ribose-phosphate pyrophosphokinase (EC 2.7.6.1) |
|
|
Ribose-phosphate pyrophosphokinase (EC 2.7.6.1) |
| nadV |
Gene: ACIAD0963: Nicotinamide phosphoribosyltransferase (EC 2.4.2.12) |
Gene: AB57_2114: Nicotinamide phosphoribosyltransferase (EC 2.4.2.12) |
Gene: Psyc_1914: Nicotinamide phosphoribosyltransferase (EC 2.4.2.12) |
Gene: PsycPRwf_1852: Nicotinamide phosphoribosyltransferase (EC 2.4.2.12) |
Nicotinamide phosphoribosyltransferase (EC 2.4.2.12) |
| nrtR |
Gene: ACIAD0962: Nudix-related transcriptional regulator NrtR |
Gene: AB57_2113: Nudix-related transcriptional regulator NrtR |
|
|
Nudix-related transcriptional regulator NrtR |
Bluish color - the gene is in regulated operon. Different regulated operons are shown in different shades of blue.
Red color - the gene is in non-regulated operon.
Gray color - the orthologous gene is absent.
The star symbol - the TFBS is located in upstream region of this gene.
The number - the numeber of homologs (shown only if it is greater than one).
|
Regulated Genes | [ Tab delimited format ] | DOWNLOAD |
|
Regulatory Sites | [ FASTA format ] | DOWNLOAD |