Regulon of NrtR in Pseudomonas entomophila L48

Properties
Regulator type:	Transcription factor
TF locus tag:	PSEEN2060
Regulator family:	NrtR
Regulation mode:	repressor
Biological process:	NAD biosynthesis
Effector:	Adenosine diphosphate ribose
Regulog:	NrtR - Pseudomonadaceae
Statistics of regulated genes:
- Genes	3
- Operons	2
Visualization:
	Allows to visualize regulon content in the context of metabolic pathways

Built upon 10 sites [see more]

Member of regulog collections

By taxonomy - Pseudomonadaceae
By trascription factor - NrtR
By TF family - NrtR
By effector - Adenosine diphosphate ribose
By pathway - NAD biosynthesis

Regulated operons
	Locus Tag	Name	Function
Position: -51 Score: 5.3 Sequence: TTAATGCACCAGGTGAATTAT Locus tag: PSEEN2059 Name: pncA Funciton: Nicotinamidase (EC 3.5.1.19) Locus tag: PSEEN2058 Name: pncB Funciton: Nicotinate phosphoribosyltransferase (EC 2.4.2.11)
	PSEEN2059	pncA	Nicotinamidase (EC 3.5.1.19)
	PSEEN2058	pncB	Nicotinate phosphoribosyltransferase (EC 2.4.2.11)
Position: -113 Score: 5.3 Sequence: ATAATTCACCTGGTGCATTAA Locus tag: PSEEN2060 Name: nrtR Funciton: Nudix-related transcriptional regulator NrtR
	PSEEN2060	nrtR	Nudix-related transcriptional regulator NrtR

Export
	Regulated Genes	[ Tab delimited format ]	DOWNLOAD
	Regulatory Sites	[ FASTA format ]	DOWNLOAD