Regulon of NrtR in Proteus mirabilis HI4320

Properties
Regulator type:	Transcription factor
TF locus tag:	PMI2395
Regulator family:	NrtR
Regulation mode:	repressor
Biological process:	NAD biosynthesis
Effector:	Adenosine diphosphate ribose
Regulog:	NrtR - Enterobacteriales
Statistics of regulated genes:
- Genes	3
- Operons	2
Visualization:
	Allows to visualize regulon content in the context of metabolic pathways

Built upon 6 sites [see more]

Member of regulog collections

By taxonomy - Enterobacteriales
By trascription factor - NrtR
By TF family - NrtR
By effector - Adenosine diphosphate ribose
By pathway - NAD biosynthesis

Regulated operons
	Locus Tag	Name	Function
Position: -140 Score: 5.1 Sequence: TTAGTGTCCTTATGACATTAA Position: -115 Score: 6.6 Sequence: ATATTGTCTTATGGACACTAT Position: -80 Score: 5.6 Sequence: TTAGTGTCTTTATGACAAAAT Locus tag: PMI2395 Name: nrtR Funciton: NUDIX-family transcriptional regulator NrtR
	PMI2395	nrtR	NUDIX-family transcriptional regulator NrtR
Position: -93 Score: 5.6 Sequence: ATTTTGTCATAAAGACACTAA Position: -58 Score: 6.6 Sequence: ATAGTGTCCATAAGACAATAT Position: -33 Score: 5.1 Sequence: TTAATGTCATAAGGACACTAA Locus tag: PMI2396 Name: nrtX Funciton: NrtR-regulated hypothetical OrfX, Band 7 protein domain Locus tag: PMI2397 Name: nrtY Funciton: NrtR-regulated hypothetical OrfY, PpnK-type ATP-NAD kinase domain
	PMI2396	nrtX	NrtR-regulated hypothetical OrfX, Band 7 protein domain
	PMI2397	nrtY	NrtR-regulated hypothetical OrfY, PpnK-type ATP-NAD kinase domain

Export
	Regulated Genes	[ Tab delimited format ]	DOWNLOAD
	Regulatory Sites	[ FASTA format ]	DOWNLOAD