Regulog NrtR - Enterobacteriales

Properties
Regulator type:	Transcription factor
Regulator family:	NrtR
Regulation mode:	repressor
Biological process:	NAD biosynthesis
Effector:	Adenosine diphosphate ribose
Phylum:	Proteobacteria/gamma
Visualization:
	Allows to visualize regulog content in the context of metabolic pathways

Built upon 6 sites [see more]

Member of regulog collections

By taxonomy - Enterobacteriales
By trascription factor - NrtR
By TF family - NrtR
By effector - Adenosine diphosphate ribose
By pathway - NAD biosynthesis

Statistics of regulated genes
Genome	Genes	Operons
Escherichia coli str. K-12 substr. MG1655
Salmonella typhimurium LT2
Citrobacter koseri ATCC BAA-895
Klebsiella pneumoniae subsp. pneumoniae MGH 78578
Enterobacter sp. 638
Erwinia amylovora ATCC 49946
Yersinia pestis KIM
Serratia proteamaculans 568
Erwinia carotovora subsp. atroseptica SCRI1043
Edwardsiella tarda EIB202
Proteus mirabilis HI4320	3	2
Photorhabdus luminescens subsp. laumondii TTO1

Clusters of co-Regulated Orthologous operoNs (CRONs)
Genes													Function

CRON 1.
nrtX	Escherichia coli str. K-12 substr. MG1655	Salmonella typhimurium LT2	Citrobacter koseri ATCC BAA-895	Klebsiella pneumoniae subsp. pneumoniae MGH 78578	Enterobacter sp. 638	Erwinia amylovora ATCC 49946	Yersinia pestis KIM	Serratia proteamaculans 568	Erwinia carotovora subsp. atroseptica SCRI1043	Edwardsiella tarda EIB202	* Proteus mirabilis HI4320 Site: position = -33 score = 5.05885 sequence = TTAATGTCATAAGGACACTAA Site: position = -58 score = 6.59727 sequence = ATAGTGTCCATAAGACAATAT Site: position = -93 score = 5.63206 sequence = ATTTTGTCATAAAGACACTAA Gene: PMI2396: NrtR-regulated hypothetical OrfX, Band 7 protein domain	Photorhabdus luminescens subsp. laumondii TTO1	NrtR-regulated hypothetical OrfX, Band 7 protein domain
nrtY	Escherichia coli str. K-12 substr. MG1655	Salmonella typhimurium LT2	Citrobacter koseri ATCC BAA-895	Klebsiella pneumoniae subsp. pneumoniae MGH 78578	Enterobacter sp. 638	Erwinia amylovora ATCC 49946	Yersinia pestis KIM	Serratia proteamaculans 568	Erwinia carotovora subsp. atroseptica SCRI1043	Edwardsiella tarda EIB202	Proteus mirabilis HI4320 Gene: PMI2397: NrtR-regulated hypothetical OrfY, PpnK-type ATP-NAD kinase domain	Photorhabdus luminescens subsp. laumondii TTO1	NrtR-regulated hypothetical OrfY, PpnK-type ATP-NAD kinase domain

CRON 2.
nrtR	Escherichia coli str. K-12 substr. MG1655	Salmonella typhimurium LT2	Citrobacter koseri ATCC BAA-895	Klebsiella pneumoniae subsp. pneumoniae MGH 78578	Enterobacter sp. 638	Erwinia amylovora ATCC 49946	Yersinia pestis KIM	Serratia proteamaculans 568	Erwinia carotovora subsp. atroseptica SCRI1043	Edwardsiella tarda EIB202	* Proteus mirabilis HI4320 Site: position = -115 score = 6.59727 sequence = ATATTGTCTTATGGACACTAT Site: position = -80 score = 5.63206 sequence = TTAGTGTCTTTATGACAAAAT Site: position = -140 score = 5.05885 sequence = TTAGTGTCCTTATGACATTAA Gene: PMI2395: NUDIX-family transcriptional regulator NrtR	Photorhabdus luminescens subsp. laumondii TTO1	NUDIX-family transcriptional regulator NrtR

Bluish color - the gene is in regulated operon. Different regulated operons are shown in different shades of blue.

Red color - the gene is in non-regulated operon.

Gray color - the orthologous gene is absent.

The star symbol - the TFBS is located in upstream region of this gene.

The number - the numeber of homologs (shown only if it is greater than one).

Export
	Regulated Genes	[ Tab delimited format ]	DOWNLOAD
	Regulatory Sites	[ FASTA format ]	DOWNLOAD

Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes -- version 3.2 --

Regulog NrtR - Enterobacteriales

Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes
-- version 3.2 --