Regulog NrtR - Enterobacteriales
| Regulator type: | Transcription factor |
| Regulator family: | NrtR |
| Regulation mode: | repressor |
| Biological process: | NAD biosynthesis |
| Effector: | Adenosine diphosphate ribose |
| Phylum: | Proteobacteria/gamma |
| Visualization: | |
|
Allows to visualize regulog content in the context of metabolic pathways |
Member of regulog collections
- By taxonomy - Enterobacteriales
- By trascription factor - NrtR
- By TF family - NrtR
- By effector - Adenosine diphosphate ribose
- By pathway - NAD biosynthesis
| Genome | Genes | Operons |
|---|---|---|
| Escherichia coli str. K-12 substr. MG1655 | ||
| Salmonella typhimurium LT2 | ||
| Citrobacter koseri ATCC BAA-895 | ||
| Klebsiella pneumoniae subsp. pneumoniae MGH 78578 | ||
| Enterobacter sp. 638 | ||
| Erwinia amylovora ATCC 49946 | ||
| Yersinia pestis KIM | ||
| Serratia proteamaculans 568 | ||
| Erwinia carotovora subsp. atroseptica SCRI1043 | ||
| Edwardsiella tarda EIB202 | ||
| Proteus mirabilis HI4320 | 3 | 2 |
| Photorhabdus luminescens subsp. laumondii TTO1 |
| Genes | Function | ||||||||||||
|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
| CRON 1. | |||||||||||||
| nrtX |
|
|
|
|
|
|
|
|
|
|
*
Proteus mirabilis HI4320 Site: position = -33 score = 5.05885 sequence = TTAATGTCATAAGGACACTAA Site: position = -58 score = 6.59727 sequence = ATAGTGTCCATAAGACAATAT Site: position = -93 score = 5.63206 sequence = ATTTTGTCATAAAGACACTAA Gene: PMI2396: NrtR-regulated hypothetical OrfX, Band 7 protein domain |
|
NrtR-regulated hypothetical OrfX, Band 7 protein domain |
| nrtY |
|
|
|
|
|
|
|
|
|
|
Gene: PMI2397: NrtR-regulated hypothetical OrfY, PpnK-type ATP-NAD kinase domain |
|
NrtR-regulated hypothetical OrfY, PpnK-type ATP-NAD kinase domain |
| CRON 2. | |||||||||||||
| nrtR |
|
|
|
|
|
|
|
|
|
|
*
Proteus mirabilis HI4320 Site: position = -115 score = 6.59727 sequence = ATATTGTCTTATGGACACTAT Site: position = -80 score = 5.63206 sequence = TTAGTGTCTTTATGACAAAAT Site: position = -140 score = 5.05885 sequence = TTAGTGTCCTTATGACATTAA Gene: PMI2395: NUDIX-family transcriptional regulator NrtR |
|
NUDIX-family transcriptional regulator NrtR |
Bluish color - the gene is in regulated operon. Different regulated operons are shown in different shades of blue.
Red color - the gene is in non-regulated operon.
Gray color - the orthologous gene is absent.
The star symbol - the TFBS is located in upstream region of this gene.
The number - the numeber of homologs (shown only if it is greater than one).
|
Regulated Genes | [ Tab delimited format ] | DOWNLOAD |
|
Regulatory Sites | [ FASTA format ] | DOWNLOAD |