Regulon of NadQ in Delftia acidovorans SPH-1

Properties
Regulator type:	Transcription factor
TF locus tag:	Daci_1540
Regulator family:	NadQ
Regulation mode:	repressor
Biological process:	NAD biosynthesis
Effector:
Regulog:	NadQ - Comamonadaceae
Statistics of regulated genes:
- Genes	4
- Operons	2
Visualization:
	Allows to visualize regulon content in the context of metabolic pathways

Built upon 6 sites [see more]

Member of regulog collections

By taxonomy - Comamonadaceae
By trascription factor - NadQ
By TF family - NadQ
By pathway - NAD biosynthesis

Regulated operons
	Locus Tag	Name	Function
Position: -81 Score: 5.5 Sequence: TTATGCTCGTATCTAGCATAA Position: -11 Score: 6.2 Sequence: ATATACTCAAAATGAGCATTA Locus tag: Daci_1541 Name: nadC Funciton: Quinolinate phosphoribosyltransferase [decarboxylating] (EC 2.4.2.19) Locus tag: Daci_1542 Name: null Funciton: Uncharacterized protein UPF0065
	Daci_1541	nadC	Quinolinate phosphoribosyltransferase [decarboxylating] (EC 2.4.2.19)
	Daci_1542		Uncharacterized protein UPF0065
Position: -67 Score: 6.2 Sequence: TAATACTCAAATTGAGCATAT Locus tag: Daci_2150 Name: nadA Funciton: Quinolinate synthetase (EC 4.1.99.-) Locus tag: Daci_2149 Name: nadB Funciton: L-aspartate oxidase (EC 1.4.3.16)
	Daci_2150	nadA	Quinolinate synthetase (EC 4.1.99.-)
	Daci_2149	nadB	L-aspartate oxidase (EC 1.4.3.16)

Export
	Regulated Genes	[ Tab delimited format ]	DOWNLOAD
	Regulatory Sites	[ FASTA format ]	DOWNLOAD