Regulon of PirR in Cyanothece sp. ATCC 51142

Properties
Regulator type:	Transcription factor
TF locus tag:	cce_3753
Regulator family:	LysR
Regulation mode:	repressor
Biological process:	Salt stress response
Effector:
Regulog:	PirR - Cyanobacteria
Statistics of regulated genes:
- Genes	1
- Operons	1
Visualization:
	Allows to visualize regulon content in the context of metabolic pathways

Built upon 11 sites [see more]

Member of regulog collections

By taxonomy - Cyanobacteria
By TF family - LysR
By pathway - Salt stress response

Regulated operons
	Locus Tag	Name	Function
Position: -51 Score: 5.1 Sequence: TTGTGTCTTTTTTAGATACTT Position: -22 Score: 5.3 Sequence: TTGTCAATCATTTAGATACAA Position: 19 Score: 5.3 Sequence: TTGTCTTTTATTTAAAAACAA Locus tag: cce_2769 Name: pirA Funciton: Pirin-like protein
	cce_2769	pirA	Pirin-like protein

Export
	Regulated Genes	[ Tab delimited format ]	DOWNLOAD
	Regulatory Sites	[ FASTA format ]	DOWNLOAD