Regulog PirR - Cyanobacteria

Member of regulog collections
- By taxonomy - Cyanobacteria
- By TF family - LysR
- By pathway - Salt stress response
Genome | Genes | Operons |
---|---|---|
Cyanothece sp. ATCC 51142 | 1 | 1 |
Cyanothece sp. PCC 7425 | ||
Cyanothece sp. PCC 8801 | ||
Gloeobacter violaceus PCC 7421 | ||
Microcystis aeruginosa NIES-843 | ||
Nostoc sp. PCC 7120 | ||
Prochlorococcus marinus str. MIT 9313 | ||
Synechococcus elongatus PCC 7942 | ||
Synechococcus sp. JA-3-3Ab | ||
Synechococcus sp. PCC 7002 | 2 | 2 |
Synechococcus sp. WH 8102 | ||
Synechocystis sp. PCC 6803 | 2 | 2 |
Thermosynechococcus elongatus BP-1 | ||
Trichodesmium erythraeum IMS101 |
Genes | Function | ||||||||||||||
---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
CRON 1. | |||||||||||||||
pirA |
*
Cyanothece sp. ATCC 51142 Site: position = -51 score = 5.05629 sequence = TTGTGTCTTTTTTAGATACTT Site: position = -22 score = 5.34322 sequence = TTGTCAATCATTTAGATACAA Site: position = 19 score = 5.29593 sequence = TTGTCTTTTATTTAAAAACAA Gene: cce_2769: Pirin-like protein |
Gene: Cyan7425_4378: Pirin-like protein |
Gene: PCC8801_3564: Pirin-like protein |
Gene: glr1823: Pirin-like protein |
Gene: MAE_12890: Pirin-like protein |
Gene: all1172: Pirin-like protein |
|
|
|
*
Synechococcus sp. PCC 7002 Site: position = -115 score = 5.31593 sequence = TTGTTTCTTTTTGAGATACAT Site: position = -74 score = 5.08068 sequence = TTGTCTTTTATTTGGCGGCAA Gene: SYNPCC7002_A2717: Pirin-like protein |
|
*
Synechocystis sp. PCC 6803 Site: position = -118 score = 5.34187 sequence = TTGTCCCTATTTTGGATGCAA Site: position = -77 score = 5.03111 sequence = TTGTCTTTATTGGGGATGCAA Gene: sll1773: Pirin-like protein |
|
Gene: Tery_0103: Pirin-like protein |
Pirin-like protein |
CRON 2. | |||||||||||||||
pirR |
Gene: cce_3753: Salt stress response transcriptional regulator, LysR family |
|
|
|
|
|
|
|
|
*
Synechococcus sp. PCC 7002 Site: position = -143 score = 5.08068 sequence = TTGCCGCCAAATAAAAGACAA Site: position = -102 score = 5.31593 sequence = ATGTATCTCAAAAAGAAACAA Gene: SYNPCC7002_A2718: Salt stress response transcriptional regulator, LysR family |
|
*
Synechocystis sp. PCC 6803 Site: position = -73 score = 5.03111 sequence = TTGCATCCCCAATAAAGACAA Site: position = -32 score = 5.34187 sequence = TTGCATCCAAAATAGGGACAA Gene: slr1871: Salt stress response transcriptional regulator, LysR family |
|
|
Salt stress response transcriptional regulator, LysR family |
Bluish color - the gene is in regulated operon. Different regulated operons are shown in different shades of blue.
Red color - the gene is in non-regulated operon.
Gray color - the orthologous gene is absent.
The star symbol - the TFBS is located in upstream region of this gene.
The number - the numeber of homologs (shown only if it is greater than one).
![]() |
Regulated Genes | [ Tab delimited format ] | DOWNLOAD |
![]() |
Regulatory Sites | [ FASTA format ] | DOWNLOAD |