Regulon of Dbac_1936 in Desulfomicrobium baculatum DSM 4028

Properties
Regulator type:	Transcription factor
TF locus tag:	Dbac_1936
Regulator family:	ArsR
Regulation mode:
Biological process:
Effector:
Regulog:	Dbac_1936 - Desulfovibrionales
Statistics of regulated genes:
- Genes	3
- Operons	1
Visualization:
	Allows to visualize regulon content in the context of metabolic pathways

Built upon 1 sites [see more]

Member of regulog collections

By taxonomy - Desulfovibrionales
By TF family - ArsR

Regulated operons
	Locus Tag	Name	Function
Position: -49 Score: 7.1 Sequence: CATATTAATATTTGTTTATATG Locus tag: Dbac_1936 Name: null Funciton: transcriptional regulator, ArsR family Locus tag: Dbac_1937 Name: null Funciton: hypothetical protein Locus tag: Dbac_1938 Name: null Funciton: hypothetical protein
	Dbac_1936		transcriptional regulator, ArsR family
	Dbac_1937		hypothetical protein
	Dbac_1938		hypothetical protein

Export
	Regulated Genes	[ Tab delimited format ]	DOWNLOAD
	Regulatory Sites	[ FASTA format ]	DOWNLOAD