Regulon of GudR in Oceanobacillus iheyensis HTE831

Properties
Regulator type:	Transcription factor
TF locus tag:	OB2842
Regulator family:	GntR/Others
Regulation mode:	repressor
Biological process:	Glucarate utilization; Galactarate utilization
Effector:
Regulog:	GudR - Bacillales
Statistics of regulated genes:
- Genes	7
- Operons	1
Visualization:
	Allows to visualize regulon content in the context of metabolic pathways

Built upon 7 sites [see more]

Member of regulog collections

By taxonomy - Bacillales
By TF family - GntR/Others
By pathway - Glucarate utilization
By pathway - Galactarate utilization

Regulated operons
	Locus Tag	Name	Function
Position: -90 Score: 6.6 Sequence: TTTATTTGTCGGACAAATAAA Locus tag: OB2842 Name: gudR Funciton: Transcriptional regulator for glucarate/galactarate utilization, GntR family Locus tag: OB2841 Name: kdgD Funciton: 5-dehydro-4-deoxyglucarate dehydratase (EC 4.2.1.41) Locus tag: OB2840 Name: kgsD Funciton: Ketoglutarate semialdehyde dehydrogenase (EC 1.2.1.26) Locus tag: OB2839 Name: tctB_Gud Funciton: Tripartite tricarboxylate transporter family small permease component, putative transporter for glucarate Locus tag: OB2838 Name: tctA_Gud Funciton: Tripartite tricarboxylate transporter family large permease component, putative transporter for glucarate Locus tag: OB2837 Name: tctC_Gud Funciton: Tripartite tricarboxylate transporter family receptor, putative transporter for glucarate Locus tag: OB2836 Name: gudD Funciton: Glucarate dehydratase (EC 4.2.1.40)
	OB2842	gudR	Transcriptional regulator for glucarate/galactarate utilization, GntR family
	OB2841	kdgD	5-dehydro-4-deoxyglucarate dehydratase (EC 4.2.1.41)
	OB2840	kgsD	Ketoglutarate semialdehyde dehydrogenase (EC 1.2.1.26)
	OB2839	tctB_Gud	Tripartite tricarboxylate transporter family small permease component, putative transporter for glucarate
	OB2838	tctA_Gud	Tripartite tricarboxylate transporter family large permease component, putative transporter for glucarate
	OB2837	tctC_Gud	Tripartite tricarboxylate transporter family receptor, putative transporter for glucarate
	OB2836	gudD	Glucarate dehydratase (EC 4.2.1.40)

Export
	Regulated Genes	[ Tab delimited format ]	DOWNLOAD
	Regulatory Sites	[ FASTA format ]	DOWNLOAD