Regulon of SdpR in Paenibacillus sp. JDR-2

Properties
Regulator type:	Transcription factor
TF locus tag:	Pjdr2_5471
Regulator family:	ArsR
Regulation mode:	repressor
Biological process:	Toxin-antitoxin system
Effector:	SdpI, signal transduction protein
Regulog:	SdpR - Bacillales
Statistics of regulated genes:
- Genes	2
- Operons	1
Visualization:
	Allows to visualize regulon content in the context of metabolic pathways

Built upon 9 sites [see more]

Member of regulog collections

By taxonomy - Bacillales
By TF family - ArsR
By effector - SdpI, signal transduction protein
By pathway - Toxin-antitoxin system

Regulated operons
	Locus Tag	Name	Function
Position: -54 Score: 6.4 Sequence: ATTTAGAATATTATCTAAAT Locus tag: Pjdr2_5471 Name: sdpR Funciton: Transcriptional regulator of SdpC resistance operon Locus tag: Pjdr2_5470 Name: sdpI Funciton: Integral membrane SdpC antitoxin
	Pjdr2_5471	sdpR	Transcriptional regulator of SdpC resistance operon
	Pjdr2_5470	sdpI	Integral membrane SdpC antitoxin

Export
	Regulated Genes	[ Tab delimited format ]	DOWNLOAD
	Regulatory Sites	[ FASTA format ]	DOWNLOAD