Regulog SdpR - Bacillales
| Regulator type: | Transcription factor |
| Regulator family: | ArsR |
| Regulation mode: | repressor |
| Biological process: | Toxin-antitoxin system |
| Effector: | SdpI, signal transduction protein |
| Phylum: | Firmicutes |
| Visualization: | |
|
Allows to visualize regulog content in the context of metabolic pathways |
Member of regulog collections
- By taxonomy - Bacillales
- By TF family - ArsR
- By effector - SdpI, signal transduction protein
- By pathway - Toxin-antitoxin system
| Genome | Genes | Operons |
|---|---|---|
| Bacillus subtilis subsp. subtilis str. 168 | 2 | 1 |
| Bacillus amyloliquefaciens FZB42 | ||
| Bacillus pumilus SAFR-032 | ||
| Bacillus licheniformis DSM 13 | 2 | 1 |
| Anoxybacillus flavithermus WK1 | 2 | 1 |
| Geobacillus kaustophilus HTA426 | 2 | 1 |
| Bacillus cereus ATCC 14579 | 2 | 1 |
| Bacillus halodurans C-125 | 2 | 1 |
| Bacillus clausii KSM-K16 | 2 | 1 |
| Oceanobacillus iheyensis HTE831 | ||
| Paenibacillus sp. JDR-2 | 2 | 1 |
| Genes | Function | |||||||||||
|---|---|---|---|---|---|---|---|---|---|---|---|---|
| CRON 1. | ||||||||||||
| sdpR |
*
Bacillus subtilis subsp. subtilis str. 168 Site: position = -53 score = 6.19685 sequence = ATTTATACAAATATCTAAAT Gene: BSU33790: Transcriptional regulator of SdpC resistance operon |
|
|
*
Bacillus licheniformis DSM 13 Site: position = -42 score = 6.28889 sequence = ATTTAGTTAAATAACTAAAT Gene: BLi00787: Transcriptional regulator of SdpC resistance operon |
*
Anoxybacillus flavithermus WK1 Site: position = -71 score = 6.06786 sequence = AATTAGAAATTTGTCTAAAT Site: position = -32 score = 6.41475 sequence = ATTTAGAAATTTGTCTAAAT Gene: Aflv_1587: Transcriptional regulator of SdpC resistance operon |
*
Geobacillus kaustophilus HTA426 Site: position = -148 score = 5.42742 sequence = ATTTAGATGTTTTTCTAAAC Gene: GK2134: Transcriptional regulator of SdpC resistance operon |
*
Bacillus cereus ATCC 14579 Site: position = -47 score = 6.07054 sequence = GTTTAGATAAATATCTAAAT Gene: BC4834: Transcriptional regulator of SdpC resistance operon |
*
Bacillus halodurans C-125 Site: position = -42 score = 5.8714 sequence = ATTTAAGTAATTGCTTAAAT Gene: BH0945: Transcriptional regulator of SdpC resistance operon |
*
Bacillus clausii KSM-K16 Site: position = -54 score = 5.5878 sequence = ATTTAAGTAATTTCTTAATT Gene: ABC3711: Transcriptional regulator of SdpC resistance operon |
|
*
Paenibacillus sp. JDR-2 Site: position = -54 score = 6.35878 sequence = ATTTAGAATATTATCTAAAT Gene: Pjdr2_5471: Transcriptional regulator of SdpC resistance operon |
Transcriptional regulator of SdpC resistance operon |
| sdpI |
Gene: BSU33780: Integral membrane SdpC antitoxin |
|
|
Gene: BLi00786: Integral membrane SdpC antitoxin |
Gene: Aflv_1586: Integral membrane SdpC antitoxin |
Gene: GK2133: Integral membrane SdpC antitoxin |
Gene: BC4833: Integral membrane SdpC antitoxin |
Gene: BH0946: Integral membrane SdpC antitoxin |
Gene: ABC3712: Integral membrane SdpC antitoxin |
|
Gene: Pjdr2_5470: Integral membrane SdpC antitoxin |
Integral membrane SdpC antitoxin |
Bluish color - the gene is in regulated operon. Different regulated operons are shown in different shades of blue.
Red color - the gene is in non-regulated operon.
Gray color - the orthologous gene is absent.
The star symbol - the TFBS is located in upstream region of this gene.
The number - the numeber of homologs (shown only if it is greater than one).
|
Regulated Genes | [ Tab delimited format ] | DOWNLOAD |
|
Regulatory Sites | [ FASTA format ] | DOWNLOAD |