Regulon of CymR in Paenibacillus sp. JDR-2

Properties
Regulator type:	Transcription factor
TF locus tag:	Pjdr2_4358
Regulator family:	Rrf2
Regulation mode:	repressor
Biological process:	Cysteine metabolism
Effector:	O-acetyl-L-serine; CysK, cysteine synthetase
Regulog:	CymR - Bacillales
Statistics of regulated genes:
- Genes	29
- Operons	9
Visualization:
	Allows to visualize regulon content in the context of metabolic pathways

Built upon 65 sites [see more]

Member of regulog collections

By taxonomy - Bacillales
By TF family - Rrf2
By effector - O-acetyl-L-serine
By effector - CysK, cysteine synthetase
By pathway - Cysteine metabolism

Regulated operons
	Locus Tag	Name	Function
Position: -45 Score: 5.2 Sequence: AATAGCATATGAATTTACTTGGAATTA Locus tag: Pjdr2_5647 Name: cysH Funciton: Phosphoadenylyl-sulfate reductase (EC 1.8.4.8)
	Pjdr2_5647	cysH	Phosphoadenylyl-sulfate reductase (EC 1.8.4.8)
Position: -55 Score: 6.1 Sequence: TAATTCTTAGTAAGTTTATAGGAATTA Locus tag: Pjdr2_5233 Name: ytmI Funciton: Putative N-acetyltransferase Locus tag: Pjdr2_5232 Name: null Funciton: Extracellular solute-binding protein family 3 Locus tag: Pjdr2_5231 Name: ytmL Funciton: Sulfur-containing amino acid ABC transporter (permease) Locus tag: Pjdr2_5230 Name: ytmM Funciton: Sulfur-containing amino acid ABC transporter (permease) Locus tag: Pjdr2_5229 Name: ytmN Funciton: Sulfur-containing amino-acid ABC transporter (ATP-binding protein) Locus tag: Pjdr2_5228 Name: null Funciton: Luciferase-like monooxygenase Locus tag: Pjdr2_5227 Name: ytnL Funciton: Putative aminohydrolase Locus tag: Pjdr2_5226 Name: null Funciton: Hypothetical protein Locus tag: Pjdr2_5225 Name: null Funciton: Nitrilotriacetate monooxygenase protein component A Locus tag: Pjdr2_5224 Name: null Funciton: N-acyl-L-amino acid amidohydrolase
	Pjdr2_5233	ytmI	Putative N-acetyltransferase
	Pjdr2_5232		Extracellular solute-binding protein family 3
	Pjdr2_5231	ytmL	Sulfur-containing amino acid ABC transporter (permease)
	Pjdr2_5230	ytmM	Sulfur-containing amino acid ABC transporter (permease)
	Pjdr2_5229	ytmN	Sulfur-containing amino-acid ABC transporter (ATP-binding protein)
	Pjdr2_5228		Luciferase-like monooxygenase
	Pjdr2_5227	ytnL	Putative aminohydrolase
	Pjdr2_5226		Hypothetical protein
	Pjdr2_5225		Nitrilotriacetate monooxygenase protein component A
	Pjdr2_5224		N-acyl-L-amino acid amidohydrolase
Position: -148 Score: 5.1 Sequence: AATTCCCCATAGAAATAGTCGGATTTA Position: -41 Score: 5 Sequence: TAATTCCAATCAAACAACTTGGATTAG Locus tag: Pjdr2_6037 Name: yhcL Funciton: Sodium-cystine symporter
	Pjdr2_6037	yhcL	Sodium-cystine symporter
Position: -50 Score: 5.2 Sequence: TAAATCCGATTAAACAAATAAGTAAAG Locus tag: Pjdr2_0760 Name: ssuA Funciton: Aliphatic sulfonate ABC transporter (binding lipoprotein) Locus tag: Pjdr2_0761 Name: null Funciton: Taurine dioxygenase Locus tag: Pjdr2_0762 Name: null Funciton: Stress responsive alpha-beta barrel domain protein
	Pjdr2_0760	ssuA	Aliphatic sulfonate ABC transporter (binding lipoprotein)
	Pjdr2_0761		Taurine dioxygenase
	Pjdr2_0762		Stress responsive alpha-beta barrel domain protein
Position: -70 Score: 5.3 Sequence: TAATTCCAACTATTCCAATAAGGAAAA Locus tag: Pjdr2_0756 Name: ssuB Funciton: Aliphatic sulfonate ABC transporter (ATP-binding protein)
	Pjdr2_0756	ssuB	Aliphatic sulfonate ABC transporter (ATP-binding protein)
Position: -53 Score: 4.9 Sequence: TAATTCCAAGTAAATCGGTGTGAAAAA Locus tag: Pjdr2_6187 Name: ssuB Funciton: Aliphatic sulfonate ABC transporter (ATP-binding protein) Locus tag: Pjdr2_6186 Name: ssuA Funciton: Aliphatic sulfonate ABC transporter (binding lipoprotein) Locus tag: Pjdr2_6185 Name: ssuC Funciton: aliphatic sulfonate ABC transporter (permease) Locus tag: Pjdr2_6184 Name: ssuC Funciton: aliphatic sulfonate ABC transporter (permease) Locus tag: Pjdr2_6183 Name: yxeK Funciton: Putative monooxygenase
	Pjdr2_6187	ssuB	Aliphatic sulfonate ABC transporter (ATP-binding protein)
	Pjdr2_6186	ssuA	Aliphatic sulfonate ABC transporter (binding lipoprotein)
	Pjdr2_6185	ssuC	aliphatic sulfonate ABC transporter (permease)
	Pjdr2_6184	ssuC	aliphatic sulfonate ABC transporter (permease)
	Pjdr2_6183	yxeK	Putative monooxygenase
Position: -105 Score: 5.2 Sequence: TAAATCCGATTAATAAGGTTGGAAAAA Locus tag: Pjdr2_5106 Name: yrrT Funciton: SAM-dependent methyltransferase Locus tag: Pjdr2_5105 Name: mccA Funciton: Cystathionine beta-synthase (EC 4.2.1.22) Locus tag: Pjdr2_5104 Name: mccB Funciton: Cystathionine gamma-lyase (EC 4.4.1.1)
	Pjdr2_5106	yrrT	SAM-dependent methyltransferase
	Pjdr2_5105	mccA	Cystathionine beta-synthase (EC 4.2.1.22)
	Pjdr2_5104	mccB	Cystathionine gamma-lyase (EC 4.4.1.1)
Position: -44 Score: 5.7 Sequence: AAAAACCAACTAAATTAGTCGGAATAA Locus tag: Pjdr2_0074 Name: cysK Funciton: Cysteine synthase (EC 2.5.1.47)
	Pjdr2_0074	cysK	Cysteine synthase (EC 2.5.1.47)
Position: -96 Score: 4.7 Sequence: CATAACCAACTAAACAGGTAGGAATAA Locus tag: Pjdr2_4823 Name: subI Funciton: Sulfate ABC transporter (sulfate-binding protein) Locus tag: Pjdr2_4822 Name: cysT Funciton: Sulfate ABC transporter (permease) Locus tag: Pjdr2_4821 Name: cysW Funciton: Sulfate ABC transporter (permease) Locus tag: Pjdr2_4820 Name: null Funciton: Hypothetical protein
	Pjdr2_4823	subI	Sulfate ABC transporter (sulfate-binding protein)
	Pjdr2_4822	cysT	Sulfate ABC transporter (permease)
	Pjdr2_4821	cysW	Sulfate ABC transporter (permease)
	Pjdr2_4820		Hypothetical protein

Export
	Regulated Genes	[ Tab delimited format ]	DOWNLOAD
	Regulatory Sites	[ FASTA format ]	DOWNLOAD

Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes -- version 3.2 --

Regulon of CymR in Paenibacillus sp. JDR-2

Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes
-- version 3.2 --