Regulon of CymR in Bacillus pumilus SAFR-032

Properties
Regulator type:	Transcription factor
TF locus tag:	BPUM_2393
Regulator family:	Rrf2
Regulation mode:	repressor
Biological process:	Cysteine metabolism
Effector:	O-acetyl-L-serine; CysK, cysteine synthetase
Regulog:	CymR - Bacillales
Statistics of regulated genes:
- Genes	14
- Operons	4
Visualization:
	Allows to visualize regulon content in the context of metabolic pathways

Built upon 65 sites [see more]

Member of regulog collections

By taxonomy - Bacillales
By TF family - Rrf2
By effector - O-acetyl-L-serine
By effector - CysK, cysteine synthetase
By pathway - Cysteine metabolism

Regulated operons
	Locus Tag	Name	Function
Position: -40 Score: 4.6 Sequence: TtAaTaCaATaAAATTAcTcGGAgaTA Locus tag: BPUM_0057 Name: cysK Funciton: Cysteine synthase (EC 2.5.1.47)
	BPUM_0057	cysK	Cysteine synthase (EC 2.5.1.47)
Position: -89 Score: 5.5 Sequence: TAAATCCTATAAGTAAAGTGTGTTTTA Position: -61 Score: 4.9 Sequence: TTATTCCGATTGGAAAAATCAGATATG Locus tag: BPUM_2341 Name: ydbM Funciton: Acyl-CoA dehydrogenase, short-chain specific (EC 1.3.99.2)
	BPUM_2341	ydbM	Acyl-CoA dehydrogenase, short-chain specific (EC 1.3.99.2)
Position: -84 Score: 5.5 Sequence: TAAAACCGATTAATTCAATCAGAAAAA Locus tag: BPUM_0345 Name: yxeK Funciton: Putative monooxygenase Locus tag: BPUM_0346 Name: yxeL Funciton: Putative acetyltransferase Locus tag: BPUM_0347 Name: yxeM Funciton: Amino acid ABC superfamily ATP binding cassette transporter, binding protein Locus tag: BPUM_0348 Name: yxeN Funciton: Amino acid ABC superfamily ATP binding cassette transporter, membrane protein Locus tag: BPUM_0349 Name: yxeO Funciton: Amino acid ABC superfamily ATP binding cassette transporter, ABC protein Locus tag: BPUM_0350 Name: yxeP Funciton: Uncharacterized hydrolase Locus tag: BPUM_0351 Name: yxeQ Funciton: Hypothetical protein
	BPUM_0345	yxeK	Putative monooxygenase
	BPUM_0346	yxeL	Putative acetyltransferase
	BPUM_0347	yxeM	Amino acid ABC superfamily ATP binding cassette transporter, binding protein
	BPUM_0348	yxeN	Amino acid ABC superfamily ATP binding cassette transporter, membrane protein
	BPUM_0349	yxeO	Amino acid ABC superfamily ATP binding cassette transporter, ABC protein
	BPUM_0350	yxeP	Uncharacterized hydrolase
	BPUM_0351	yxeQ	Hypothetical protein
Position: -51 Score: 5.4 Sequence: TAAAACATACTATACGCATAGGAATAA Locus tag: BPUM_2363 Name: yrrT Funciton: SAM-dependent methyltransferase Locus tag: BPUM_2362 Name: mtn Funciton: 5'-methylthioadenosine nucleosidase (EC 3.2.2.16) / S-adenosylhomocysteine nucleosidase (EC 3.2.2.9) Locus tag: BPUM_2361 Name: mccA Funciton: Cystathionine beta-synthase (EC 4.2.1.22) Locus tag: BPUM_2360 Name: mccB Funciton: Cystathionine gamma-lyase (EC 4.4.1.1) Locus tag: BPUM_2359 Name: yrhC Funciton: Hypothetical protein
	BPUM_2363	yrrT	SAM-dependent methyltransferase
	BPUM_2362	mtn	5'-methylthioadenosine nucleosidase (EC 3.2.2.16) / S-adenosylhomocysteine nucleosidase (EC 3.2.2.9)
	BPUM_2361	mccA	Cystathionine beta-synthase (EC 4.2.1.22)
	BPUM_2360	mccB	Cystathionine gamma-lyase (EC 4.4.1.1)
	BPUM_2359	yrhC	Hypothetical protein

Export
	Regulated Genes	[ Tab delimited format ]	DOWNLOAD
	Regulatory Sites	[ FASTA format ]	DOWNLOAD