Regulon of CymR in Bacillus halodurans C-125

Properties
Regulator type:	Transcription factor
TF locus tag:	BH1259
Regulator family:	Rrf2
Regulation mode:	repressor
Biological process:	Cysteine metabolism
Effector:	O-acetyl-L-serine; CysK, cysteine synthetase
Regulog:	CymR - Bacillales
Statistics of regulated genes:
- Genes	14
- Operons	5
Visualization:
	Allows to visualize regulon content in the context of metabolic pathways

Built upon 65 sites [see more]

Member of regulog collections

By taxonomy - Bacillales
By TF family - Rrf2
By effector - O-acetyl-L-serine
By effector - CysK, cysteine synthetase
By pathway - Cysteine metabolism

Regulated operons
	Locus Tag	Name	Function
Position: -73 Score: 5.3 Sequence: TAAATCATATCAAATTACATGGAATTA Locus tag: BH1485 Name: BH1485 Funciton: Hypothetical protein Locus tag: BH1486 Name: cysH Funciton: Phosphoadenylyl-sulfate reductase (EC 1.8.4.8) Locus tag: BH1487 Name: sat Funciton: Sulfate adenylyltransferase, dissimilatory-type (EC 2.7.7.4) Locus tag: BH1488 Name: cysP Funciton: Sulfate permease, Pit-type
	BH1485	BH1485	Hypothetical protein
	BH1486	cysH	Phosphoadenylyl-sulfate reductase (EC 1.8.4.8)
	BH1487	sat	Sulfate adenylyltransferase, dissimilatory-type (EC 2.7.7.4)
	BH1488	cysP	Sulfate permease, Pit-type
Position: -53 Score: 5.3 Sequence: TAAAACATAGTAAACAGATATGAATTT Locus tag: BH1489 Name: cysC Funciton: Adenylylsulfate kinase (EC 2.7.1.25)
	BH1489	cysC	Adenylylsulfate kinase (EC 2.7.1.25)
Position: -87 Score: 5.7 Sequence: TAAAACCAATTTGACTTATCGGAATAA Locus tag: BH0609 Name: cysJ Funciton: Sulfite reductase [NADPH] flavoprotein alpha-component (EC 1.8.1.2) Locus tag: BH0610 Name: yvgQ Funciton: Sulfite reductase [NADPH] hemoprotein beta-component (EC 1.8.1.2)
	BH0609	cysJ	Sulfite reductase [NADPH] flavoprotein alpha-component (EC 1.8.1.2)
	BH0610	yvgQ	Sulfite reductase [NADPH] hemoprotein beta-component (EC 1.8.1.2)
Position: -39 Score: 5.2 Sequence: GAAAACCAATAAATTTACTTGGGATTA Locus tag: BH0088 Name: cysK Funciton: Cysteine synthase (EC 2.5.1.47)
	BH0088	cysK	Cysteine synthase (EC 2.5.1.47)
Position: -142 Score: 4.8 Sequence: TAAAACCCACTTGACAGATGGGGATTA Position: -50 Score: 4.6 Sequence: TAAAACAGACTTTTCCGATCTGTTTTA Locus tag: BH3125 Name: BH3125 Funciton: Hypothetical protein Locus tag: BH3126 Name: BH3126 Funciton: Hypothetical protein Locus tag: BH3127 Name: subI Funciton: Sulfate ABC transporter (sulfate-binding protein) Locus tag: BH3128 Name: cysT Funciton: Sulfate ABC transporter (permease) Locus tag: BH3129 Name: cysW Funciton: Sulfate ABC transporter (permease) Locus tag: BH3130 Name: cysA Funciton: Sulfate ABC transporter (ATP-binding protein)
	BH3125	BH3125	Hypothetical protein
	BH3126	BH3126	Hypothetical protein
	BH3127	subI	Sulfate ABC transporter (sulfate-binding protein)
	BH3128	cysT	Sulfate ABC transporter (permease)
	BH3129	cysW	Sulfate ABC transporter (permease)
	BH3130	cysA	Sulfate ABC transporter (ATP-binding protein)

Export
	Regulated Genes	[ Tab delimited format ]	DOWNLOAD
	Regulatory Sites	[ FASTA format ]	DOWNLOAD