Regulon of TrpR in Yersinia pestis KIM

Properties
Regulator type:	Transcription factor
TF locus tag:	y3726
Regulator family:	TrpR
Regulation mode:	repressor
Biological process:	Tryptophan biosynthesis
Effector:	Tryptophan
Regulog:	TrpR - Enterobacteriales
Statistics of regulated genes:
- Genes	3
- Operons	3
Visualization:
	Allows to visualize regulon content in the context of metabolic pathways

Built upon 44 sites [see more]

Member of regulog collections

By taxonomy - Enterobacteriales
By trascription factor - TrpR
By TF family - TrpR
By effector - Tryptophan
By pathway - Tryptophan biosynthesis

Regulated operons
	Locus Tag	Name	Function
Position: -283 Score: 6.2 Sequence: TGAACCAGTTAACTAGTACA Locus tag: y2051 Name: trpE Funciton: Anthranilate synthase, aminase component (EC 4.1.3.27)
	y2051	trpE	Anthranilate synthase, aminase component (EC 4.1.3.27)
Position: -24 Score: 6.1 Sequence: TGTACTAGTTAAATAGTACT Locus tag: y3726 Name: trpR Funciton: Trp operon repressor
	y3726	trpR	Trp operon repressor
Position: -139 Score: 5 Sequence: TGTACCATTCAGCTAGTACA Locus tag: y2900 Name: mtr Funciton: Tryptophan-specific transport protein
	y2900	mtr	Tryptophan-specific transport protein

Export
	Regulated Genes	[ Tab delimited format ]	DOWNLOAD
	Regulatory Sites	[ FASTA format ]	DOWNLOAD