Regulon of MalI in Serratia proteamaculans 568

Properties
Regulator type:	Transcription factor
TF locus tag:	Spro_2271
Regulator family:	LacI
Regulation mode:	repressor
Biological process:	Maltose utilization
Effector:
Regulog:	MalI - Enterobacteriales
Statistics of regulated genes:
- Genes	2
- Operons	2
Visualization:
	Allows to visualize regulon content in the context of metabolic pathways

Built upon 19 sites [see more]

Member of regulog collections

By taxonomy - Enterobacteriales
By TF family - LacI
By pathway - Maltose utilization

Regulated operons
	Locus Tag	Name	Function
Position: -159 Score: 4.6 Sequence: TCAGTAAAACGTTTTACTGG Position: -81 Score: 6.9 Sequence: TAGGTAAAACGTTTTATCTT Locus tag: Spro_2270 Name: malX Funciton: PTS system, maltose and glucose-specific IIC component (EC 2.7.1.69) / PTS system, maltose and glucose-specific IIB component (EC 2.7.1.69)
	Spro_2270	malX	PTS system, maltose and glucose-specific IIC component (EC 2.7.1.69) / PTS system, maltose and glucose-specific IIB component (EC 2.7.1.69)
Position: -137 Score: 6.7 Sequence: AAGATAAAACGTTTTACCTA Position: -59 Score: 5 Sequence: CCAGTAAAACGTTTTACTGA Locus tag: Spro_2271 Name: malI Funciton: Maltose regulon regulatory protein MalI
	Spro_2271	malI	Maltose regulon regulatory protein MalI

Export
	Regulated Genes	[ Tab delimited format ]	DOWNLOAD
	Regulatory Sites	[ FASTA format ]	DOWNLOAD