Regulog MalI - Enterobacteriales

Member of regulog collections
- By taxonomy - Enterobacteriales
- By TF family - LacI
- By pathway - Maltose utilization
Genome | Genes | Operons |
---|---|---|
Escherichia coli str. K-12 substr. MG1655 | 3 | 2 |
Salmonella typhimurium LT2 | ||
Citrobacter koseri ATCC BAA-895 | 3 | 2 |
Klebsiella pneumoniae subsp. pneumoniae MGH 78578 | 3 | 2 |
Enterobacter sp. 638 | 3 | 2 |
Erwinia amylovora ATCC 49946 | ||
Yersinia pestis KIM | ||
Serratia proteamaculans 568 | 2 | 2 |
Erwinia carotovora subsp. atroseptica SCRI1043 | ||
Edwardsiella tarda EIB202 | ||
Proteus mirabilis HI4320 | ||
Photorhabdus luminescens subsp. laumondii TTO1 |
Genes | Function | ||||||||||||
---|---|---|---|---|---|---|---|---|---|---|---|---|---|
CRON 1. | |||||||||||||
malX |
*
Escherichia coli str. K-12 substr. MG1655 Site: position = -146 score = 6.73513 sequence = CAGATAAAACGTTTTACCTT Site: position = -68 score = 6.52627 sequence = TTGATAAAACGTTTTATCTT Gene: b1621: PTS system, maltose and glucose-specific IIC component (EC 2.7.1.69) / PTS system, maltose and glucose-specific IIB component (EC 2.7.1.69) |
|
*
Citrobacter koseri ATCC BAA-895 Site: position = -148 score = 6.9929 sequence = CAGATAAAACGTTTTATCAA Site: position = -69 score = 6.87747 sequence = TAGGTAAAACGTTTTATCTT Gene: CKO_01628: PTS system, maltose and glucose-specific IIC component (EC 2.7.1.69) / PTS system, maltose and glucose-specific IIB component (EC 2.7.1.69) |
*
Klebsiella pneumoniae subsp. pneumoniae MGH 78578 Site: position = -68 score = 6.87747 sequence = TCGATAAAACGTTTTATCTT Gene: KPN_01512: PTS system, maltose and glucose-specific IIC component (EC 2.7.1.69) / PTS system, maltose and glucose-specific IIB component (EC 2.7.1.69) |
*
Enterobacter sp. 638 Site: position = -149 score = 6.76203 sequence = ACGGTAAAACGTTTTATCAA Site: position = -70 score = 6.41083 sequence = TTGGTAAAACGTTTTATCTT Gene: Ent638_1827: PTS system, maltose and glucose-specific IIC component (EC 2.7.1.69) / PTS system, maltose and glucose-specific IIB component (EC 2.7.1.69) |
|
|
*
Serratia proteamaculans 568 Site: position = -159 score = 4.5936 sequence = TCAGTAAAACGTTTTACTGG Site: position = -81 score = 6.87747 sequence = TAGGTAAAACGTTTTATCTT Gene: Spro_2270: PTS system, maltose and glucose-specific IIC component (EC 2.7.1.69) / PTS system, maltose and glucose-specific IIB component (EC 2.7.1.69) |
|
|
|
|
PTS system, maltose and glucose-specific IIC component (EC 2.7.1.69) / PTS system, maltose and glucose-specific IIB component (EC 2.7.1.69) |
malY |
Gene: b1622: Cystathionine beta-lyase (EC 4.4.1.8) / Maltose regulon modulator |
|
Gene: CKO_01629: Cystathionine beta-lyase (EC 4.4.1.8) / Maltose regulon modulator |
Gene: KPN_01511: Cystathionine beta-lyase (EC 4.4.1.8) / Maltose regulon modulator |
Gene: Ent638_1826: Cystathionine beta-lyase (EC 4.4.1.8) / Maltose regulon modulator |
|
|
|
|
|
|
|
Cystathionine beta-lyase (EC 4.4.1.8) / Maltose regulon modulator |
CRON 2. | |||||||||||||
malI |
*
Escherichia coli str. K-12 substr. MG1655 Site: position = -126 score = 6.9929 sequence = AAGATAAAACGTTTTATCAA Site: position = -48 score = 6.45985 sequence = AAGGTAAAACGTTTTATCTG Gene: b1620: Maltose regulon regulatory protein MalI |
|
*
Citrobacter koseri ATCC BAA-895 Site: position = -248 score = 4.77546 sequence = CAGCATAAACGTTTTACCCA Site: position = -127 score = 6.73513 sequence = AAGATAAAACGTTTTACCTA Site: position = -48 score = 6.10865 sequence = TTGATAAAACGTTTTATCTG Gene: CKO_01626: Maltose regulon regulatory protein MalI |
*
Klebsiella pneumoniae subsp. pneumoniae MGH 78578 Site: position = -46 score = 6.57528 sequence = AAGATAAAACGTTTTATCGA Gene: KPN_01513: Maltose regulon regulatory protein MalI |
*
Enterobacter sp. 638 Site: position = -127 score = 6.73513 sequence = AAGATAAAACGTTTTACCAA Site: position = -48 score = 5.85088 sequence = TTGATAAAACGTTTTACCGT Gene: Ent638_1828: Maltose regulon regulatory protein MalI |
|
|
*
Serratia proteamaculans 568 Site: position = -137 score = 6.73513 sequence = AAGATAAAACGTTTTACCTA Site: position = -59 score = 5.01122 sequence = CCAGTAAAACGTTTTACTGA Gene: Spro_2271: Maltose regulon regulatory protein MalI |
|
|
|
|
Maltose regulon regulatory protein MalI |
Bluish color - the gene is in regulated operon. Different regulated operons are shown in different shades of blue.
Red color - the gene is in non-regulated operon.
Gray color - the orthologous gene is absent.
The star symbol - the TFBS is located in upstream region of this gene.
The number - the numeber of homologs (shown only if it is greater than one).
![]() |
Regulated Genes | [ Tab delimited format ] | DOWNLOAD |
![]() |
Regulatory Sites | [ FASTA format ] | DOWNLOAD |