Regulon of SdaR in Escherichia coli str. K-12 substr. MG1655

Properties
Regulator type:	Transcription factor
TF locus tag:	b0162
Regulator family:	SdaR
Regulation mode:	activator
Biological process:	Glucarate utilization; Galactarate utilization
Effector:	Glycerate
Regulog:	SdaR - Enterobacteriales
Statistics of regulated genes:
- Genes	9
- Operons	4
Visualization:
	Allows to visualize regulon content in the context of metabolic pathways

Built upon 31 sites [see more]

Member of regulog collections

By taxonomy - Enterobacteriales
By trascription factor - SdaR
By TF family - SdaR
By effector - Glycerate
By pathway - Glucarate utilization
By pathway - Galactarate utilization

Regulated operons
	Locus Tag	Name	Function
Position: -69 Score: 5.3 Sequence: CTTTAGGCATTTGCACAATG Locus tag: b0162 Name: sdaR Funciton: Glycerate-responsive transcriptional regulator for hexarate utilization, SdaR family
	b0162	sdaR	Glycerate-responsive transcriptional regulator for hexarate utilization, SdaR family
Position: -186 Score: 6 Sequence: TTATGTGCATATGCTCAAAA Position: -144 Score: 4.5 Sequence: AAATTAGCATTTGCACAATG Locus tag: b3127 Name: garP Funciton: D-galactarate permease, MFS family Locus tag: b3126 Name: garL Funciton: 2-dehydro-3-deoxyglucarate aldolase (EC 4.1.2.20) Locus tag: b3125 Name: garR Funciton: 2-hydroxy-3-oxopropionate reductase (EC 1.1.1.60) Locus tag: b3124 Name: garK Funciton: Glycerate kinase (EC 2.7.1.31)
	b3127	garP	D-galactarate permease, MFS family
	b3126	garL	2-dehydro-3-deoxyglucarate aldolase (EC 4.1.2.20)
	b3125	garR	2-hydroxy-3-oxopropionate reductase (EC 1.1.1.60)
	b3124	garK	Glycerate kinase (EC 2.7.1.31)
Position: -385 Score: 4.7 Sequence: TTTCAGGCAAATGCCAGTAA Locus tag: b2789 Name: gudP Funciton: D-glucarate permease, MFS family Locus tag: b2788 Name: gudX Funciton: Glucarate dehydratase related protein (EC 4.2.1.-) Locus tag: b2787 Name: gudD Funciton: Glucarate dehydratase (EC 4.2.1.40)
	b2789	gudP	D-glucarate permease, MFS family
	b2788	gudX	Glucarate dehydratase related protein (EC 4.2.1.-)
	b2787	gudD	Glucarate dehydratase (EC 4.2.1.40)
Position: -250 Score: 4.5 Sequence: CATTGTGCAAATGCTAATTT Position: -208 Score: 6 Sequence: TTTTGAGCATATGCACATAA Locus tag: b3128 Name: garD Funciton: D-galactarate dehydratase (EC 4.2.1.42)
	b3128	garD	D-galactarate dehydratase (EC 4.2.1.42)

Export
	Regulated Genes	[ Tab delimited format ]	DOWNLOAD
	Regulatory Sites	[ FASTA format ]	DOWNLOAD