Regulog RbsR - Staphylococcaceae
| Regulator type: | Transcription factor |
| Regulator family: | LacI |
| Regulation mode: | repressor |
| Biological process: | Ribose utilization |
| Effector: | Ribose |
| Phylum: | Firmicutes |
| Visualization: | |
|
Allows to visualize regulog content in the context of metabolic pathways |
Member of regulog collections
- By taxonomy - Staphylococcaceae
- By trascription factor - RbsR
- By TF family - LacI
- By effector - Ribose
- By pathway - Ribose utilization
| Genome | Genes | Operons |
|---|---|---|
| Staphylococcus aureus subsp. aureus N315 | 3 | 1 |
| Staphylococcus capitis SK14 | ||
| Staphylococcus epidermidis ATCC 12228 | ||
| Staphylococcus carnosus subsp. carnosus TM300 | 3 | 1 |
| Staphylococcus haemolyticus JCSC1435 | ||
| Staphylococcus saprophyticus subsp. saprophyticus ATCC 15305 | ||
| Macrococcus caseolyticus JCSC5402 |
| Genes | Function | |||||||
|---|---|---|---|---|---|---|---|---|
| CRON 1. | ||||||||
| rbsU |
*
Staphylococcus aureus subsp. aureus N315 Site: position = -43 score = 7.42686 sequence = TTGGTAAAACGTTTTACTAA Gene: SA0260: Putative ribose uptake protein RbsU, GRP transporter family (TC 2.A.7.5) |
Gene: STACA0001_0973: Putative ribose uptake protein RbsU, GRP transporter family (TC 2.A.7.5) |
Gene: SE2088: Putative ribose uptake protein RbsU, GRP transporter family (TC 2.A.7.5) |
*
Staphylococcus carnosus subsp. carnosus TM300 Site: position = -63 score = 7.60951 sequence = TTAGTAAAACGTTTTACTAA Gene: Sca_2421: Putative ribose uptake protein RbsU, GRP transporter family (TC 2.A.7.5) |
|
|
|
Putative ribose uptake protein RbsU, GRP transporter family (TC 2.A.7.5) |
| rbsD |
Gene: SA0259: D-ribose pyranase (D-ribose mutarotase) (EC 5.5.1.n1) |
Gene: STACA0001_0974: D-ribose pyranase (D-ribose mutarotase) (EC 5.5.1.n1) |
Gene: SE2087: D-ribose pyranase (D-ribose mutarotase) (EC 5.5.1.n1) |
Gene: Sca_2420: D-ribose pyranase (D-ribose mutarotase) (EC 5.5.1.n1) |
Gene: SH0176: D-ribose pyranase (D-ribose mutarotase) (EC 5.5.1.n1) |
Gene: SSP1395: D-ribose pyranase (D-ribose mutarotase) (EC 5.5.1.n1) |
|
D-ribose pyranase (D-ribose mutarotase) (EC 5.5.1.n1) |
| rbsK |
Gene: SA0258: Ribokinase (EC 2.7.1.15) |
Gene: STACA0001_0975: Ribokinase (EC 2.7.1.15) |
Gene: SE2086: Ribokinase (EC 2.7.1.15) |
Gene: Sca_2419: Ribokinase (EC 2.7.1.15) |
Gene: SH0175: Ribokinase (EC 2.7.1.15) |
|
|
Ribokinase (EC 2.7.1.15) |
Bluish color - the gene is in regulated operon. Different regulated operons are shown in different shades of blue.
Red color - the gene is in non-regulated operon.
Gray color - the orthologous gene is absent.
The star symbol - the TFBS is located in upstream region of this gene.
The number - the numeber of homologs (shown only if it is greater than one).
|
Regulated Genes | [ Tab delimited format ] | DOWNLOAD |
|
Regulatory Sites | [ FASTA format ] | DOWNLOAD |