Regulog XylR - Clostridia-2
| Regulator type: | Transcription factor |
| Regulator family: | ROK |
| Regulation mode: | repressor |
| Biological process: | Xylose utilization |
| Effector: | Xylose |
| Phylum: | Firmicutes |
| Visualization: | |
|
Allows to visualize regulog content in the context of metabolic pathways |
Member of regulog collections
- By taxonomy - Clostridia-2
- By TF family - ROK
- By effector - Xylose
- By pathway - Xylose utilization
| Genome | Genes | Operons |
|---|---|---|
| Clostridium bartlettii DSM 16795 | ||
| Clostridium difficile 630 | 8 | 3 |
| Clostridium hiranonis DSM 13275 |
| Genes | Function | |||
|---|---|---|---|---|
| CRON 1. | ||||
| xylS |
|
*
Clostridium difficile 630 Site: position = -127 score = 5.51258 sequence = GTAAGTTAGTTTAATGTACAAAT Gene: CD3071: Alpha-xylosidase |
|
Alpha-xylosidase |
| CD3070 |
|
Gene: CD3070: Phosphotransferase system for xylose-containing disaccharide, EIIC component |
|
Phosphotransferase system for xylose-containing disaccharide, EIIC component |
| CD3069 |
|
Gene: CD3069: Phosphotransferase system for xylose-containing disaccharide, EIID component |
|
Phosphotransferase system for xylose-containing disaccharide, EIID component |
| CD3068 |
|
Gene: CD3068: Phosphotransferase system for xylose-containing disaccharide, EIIB component |
|
Phosphotransferase system for xylose-containing disaccharide, EIIB component |
| CD3067 |
|
Gene: CD3067: Phosphotransferase system for xylose-containing disaccharide, EIIA component |
|
Phosphotransferase system for xylose-containing disaccharide, EIIA component |
| CRON 2. | ||||
| xylR |
|
*
Clostridium difficile 630 Site: position = -123 score = 5.39712 sequence = GTTAGTATATTAAACTAACTTAT Gene: CD3066: Xylose repressor XylR, ROK family |
|
Xylose repressor XylR, ROK family |
| CRON 3. | ||||
| xylB |
|
*
Clostridium difficile 630 Site: position = -113 score = 5.44677 sequence = ATAAGTTAGTTTAATATACTAAC Gene: CD3065: Xylulose kinase (EC 2.7.1.17) |
|
Xylulose kinase (EC 2.7.1.17) |
| xylA |
|
Gene: CD3064: Xylose isomerase (EC 5.3.1.5) |
|
Xylose isomerase (EC 5.3.1.5) |
Bluish color - the gene is in regulated operon. Different regulated operons are shown in different shades of blue.
Red color - the gene is in non-regulated operon.
Gray color - the orthologous gene is absent.
The star symbol - the TFBS is located in upstream region of this gene.
The number - the numeber of homologs (shown only if it is greater than one).
|
Regulated Genes | [ Tab delimited format ] | DOWNLOAD |
|
Regulatory Sites | [ FASTA format ] | DOWNLOAD |