Regulog FruR2 - Rhodospirillales
| Regulator type: | Transcription factor |
| Regulator family: | LacI |
| Regulation mode: | repressor |
| Biological process: | Fructose utilization |
| Effector: | Fructose-1-phosphate |
| Phylum: | Proteobacteria/Alpha |
| Visualization: | |
|
Allows to visualize regulog content in the context of metabolic pathways |
Member of regulog collections
- By taxonomy - Rhodospirillales
- By TF family - LacI
- By effector - Fructose-1-phosphate
- By pathway - Fructose utilization
| Genome | Genes | Operons |
|---|---|---|
| Acetobacter pasteurianus IFO 3283-01 | ||
| Azospirillum sp. B510 | 4 | 2 |
| Gluconacetobacter diazotrophicus PAl 5 | ||
| Gluconobacter oxydans 621H | ||
| Granulibacter bethesdensis CGDNIH1 | 4 | 2 |
| Magnetospirillum magneticum AMB-1 | ||
| Magnetospirillum magnetotacticum MS-1 | ||
| Rhodospirillum centenum SW | ||
| Rhodospirillum rubrum ATCC 11170 | 4 | 2 |
| Genes | Function | |||||||||
|---|---|---|---|---|---|---|---|---|---|---|
| CRON 1. | ||||||||||
| fruR2 |
|
*
Azospirillum sp. B510 Site: position = -218 score = 5.15512 sequence = AAGTGAAAACGATTACAGTG Site: position = -106 score = 5.21953 sequence = GATTGGAAACGTTTTCAGAT Gene: AZL_c02640: Transcriptional regulator of fructose utilization, LacI family |
|
|
*
Granulibacter bethesdensis CGDNIH1 Site: position = -153 score = 5.04852 sequence = ATATGAAAACGTTTTCACAG Gene: GbCGDNIH1_0413: Transcriptional regulator of fructose utilization, LacI family |
|
|
|
*
Rhodospirillum rubrum ATCC 11170 Site: position = -106 score = 5.39204 sequence = GAGTGAAAACGATTTCACAA Gene: Rru_A1973: Transcriptional regulator of fructose utilization, LacI family |
Transcriptional regulator of fructose utilization, LacI family |
| CRON 2. | ||||||||||
| fruB |
|
*
Azospirillum sp. B510 Site: position = -175 score = 5.21953 sequence = ATCTGAAAACGTTTCCAATC Site: position = -63 score = 5.15512 sequence = CACTGTAATCGTTTTCACTT Gene: AZL_c02630: PTS system, fructose-specific IIA component (EC 2.7.1.69) / Phosphotransferase system, phosphocarrier protein HPr / Phosphoenolpyruvate-protein phosphotransferase of PTS system (EC 2.7.3.9) |
|
|
*
Granulibacter bethesdensis CGDNIH1 Site: position = -55 score = 5.04852 sequence = CTGTGAAAACGTTTTCATAT Gene: GbCGDNIH1_0412: PTS system, fructose-specific IIA component (EC 2.7.1.69) / Phosphotransferase system, phosphocarrier protein HPr / Phosphoenolpyruvate-protein phosphotransferase of PTS system (EC 2.7.3.9) |
|
|
|
*
Rhodospirillum rubrum ATCC 11170 Site: position = -142 score = 5.39204 sequence = TTGTGAAATCGTTTTCACTC Gene: Rru_A1972: PTS system, fructose-specific IIA component (EC 2.7.1.69) / Phosphotransferase system, phosphocarrier protein HPr / Phosphoenolpyruvate-protein phosphotransferase of PTS system (EC 2.7.3.9) |
PTS system, fructose-specific IIA component (EC 2.7.1.69) / Phosphotransferase system, phosphocarrier protein HPr / Phosphoenolpyruvate-protein phosphotransferase of PTS system (EC 2.7.3.9) |
| fruK |
|
Gene: AZL_c02620: 1-phosphofructokinase (EC 2.7.1.56) |
|
|
Gene: GbCGDNIH1_0411: 1-phosphofructokinase (EC 2.7.1.56) |
|
|
|
Gene: Rru_A1971: 1-phosphofructokinase (EC 2.7.1.56) |
1-phosphofructokinase (EC 2.7.1.56) |
| fruA |
|
Gene: AZL_c02610: PTS system, fructose-specific IIB component (EC 2.7.1.69) / PTS system, fructose-specific IIC component (EC 2.7.1.69) |
|
|
Gene: GbCGDNIH1_0410: PTS system, fructose-specific IIB component (EC 2.7.1.69) / PTS system, fructose-specific IIC component (EC 2.7.1.69) |
|
|
|
Gene: Rru_A1970: PTS system, fructose-specific IIB component (EC 2.7.1.69) / PTS system, fructose-specific IIC component (EC 2.7.1.69) |
PTS system, fructose-specific IIB component (EC 2.7.1.69) / PTS system, fructose-specific IIC component (EC 2.7.1.69) |
Bluish color - the gene is in regulated operon. Different regulated operons are shown in different shades of blue.
Red color - the gene is in non-regulated operon.
Gray color - the orthologous gene is absent.
The star symbol - the TFBS is located in upstream region of this gene.
The number - the numeber of homologs (shown only if it is greater than one).
|
Regulated Genes | [ Tab delimited format ] | DOWNLOAD |
|
Regulatory Sites | [ FASTA format ] | DOWNLOAD |