Statistics of regulated genes

Genome	Genes	Operons
Mycobacterium abscessus ATCC 19977
Mycobacterium avium 104
Mycobacterium flavescens PYR-GCK
Mycobacterium leprae TN
Mycobacterium marinum M
Mycobacterium smegmatis str. MC2 155	10	2
Mycobacterium sp. JLS	9	2
Mycobacterium tuberculosis H37Rv
Mycobacterium vanbaalenii PYR-1

Clusters of co-Regulated Orthologous operoNs (CRONs)

Genes										Function
CRON 1.
MSMEG_3264	Mycobacterium abscessus ATCC 19977	Mycobacterium avium 104	Mycobacterium flavescens PYR-GCK	Mycobacterium leprae TN	Mycobacterium marinum M	* Mycobacterium smegmatis str. MC2 155 Site: position = -71 score = 5.41305 sequence = TGCACAATTGTCCAGAACATCTGTTCA Gene: MSMEG_3264: Transcriptional regulator for D-threitol and erythritol utilization, DeoR family	* Mycobacterium sp. JLS Site: position = -73 score = 5.32948 sequence = TGCACATCTGTCCAGAACATCTGTTCA Site: position = -60 score = 4.5204 sequence = AGAACATCTGTTCAGGGAGAATCTGTT Gene: Mjls_2592: Transcriptional regulator for D-threitol and erythritol utilization, DeoR family	Mycobacterium tuberculosis H37Rv	Mycobacterium vanbaalenii PYR-1	Transcriptional regulator for D-threitol and erythritol utilization, DeoR family
MSMEG_3262	Mycobacterium abscessus ATCC 19977	Mycobacterium avium 104	Mycobacterium flavescens PYR-GCK	Mycobacterium leprae TN	Mycobacterium marinum M	Mycobacterium smegmatis str. MC2 155 Gene: MSMEG_3262: oxidoreductase, short-chain dehydrogenase-reductase family (kduD)	Mycobacterium sp. JLS	Mycobacterium tuberculosis H37Rv	Mycobacterium vanbaalenii PYR-1	oxidoreductase, short-chain dehydrogenase-reductase family
CRON 2.
MSMEG_3265	Mycobacterium abscessus ATCC 19977	Mycobacterium avium 104	Mycobacterium flavescens PYR-GCK	Mycobacterium leprae TN	Mycobacterium marinum M	* Mycobacterium smegmatis str. MC2 155 Site: position = -74 score = 7.63115 sequence = TGAACAGATGTTCTGGACAATTGTGCA Gene: MSMEG_3265: homolog of sorbitol dehydrogenase	* Mycobacterium sp. JLS Site: position = -71 score = 7.98138 sequence = TGAACAGATGTTCTGGACAGATGTGCA Gene: Mjls_2593: homolog of sorbitol dehydrogenase	Mycobacterium tuberculosis H37Rv	Mycobacterium vanbaalenii PYR-1	homolog of sorbitol dehydrogenase
MSMEG_3266	Mycobacterium abscessus ATCC 19977	Mycobacterium avium 104	Mycobacterium flavescens PYR-GCK	Mycobacterium leprae TN	Mycobacterium marinum M	Mycobacterium smegmatis str. MC2 155 Gene: MSMEG_3266: Predicted erythritol ABC transporter 1, substrate-binding component	Mycobacterium sp. JLS Gene: Mjls_2594: Predicted erythritol ABC transporter 1, substrate-binding component	Mycobacterium tuberculosis H37Rv	Mycobacterium vanbaalenii PYR-1	Predicted erythritol ABC transporter 1, substrate-binding component
MSMEG_3267	Mycobacterium abscessus ATCC 19977	Mycobacterium avium 104	Mycobacterium flavescens PYR-GCK	Mycobacterium leprae TN	Mycobacterium marinum M	Mycobacterium smegmatis str. MC2 155 Gene: MSMEG_3267: Predicted erythritol ABC transporter, permease protein	Mycobacterium sp. JLS Gene: Mjls_2595: Predicted erythritol ABC transporter, permease protein	Mycobacterium tuberculosis H37Rv	Mycobacterium vanbaalenii PYR-1	Predicted erythritol ABC transporter, permease protein
MSMEG_3268	Mycobacterium abscessus ATCC 19977	Mycobacterium avium 104	Mycobacterium flavescens PYR-GCK	Mycobacterium leprae TN	Mycobacterium marinum M	Mycobacterium smegmatis str. MC2 155 Gene: MSMEG_3268: Predicted erythritol ABC transporter, permease protein	Mycobacterium sp. JLS Gene: Mjls_2596: Predicted erythritol ABC transporter, permease protein	Mycobacterium tuberculosis H37Rv	Mycobacterium vanbaalenii PYR-1	Predicted erythritol ABC transporter, permease protein
MSMEG_3269	Mycobacterium abscessus ATCC 19977	Mycobacterium avium 104	Mycobacterium flavescens PYR-GCK	Mycobacterium leprae TN	Mycobacterium marinum M	Mycobacterium smegmatis str. MC2 155 Gene: MSMEG_3269: Predicted erythritol ABC transporter 1, ATP-binding protein	Mycobacterium sp. JLS Gene: Mjls_2597: Predicted erythritol ABC transporter 1, ATP-binding protein	Mycobacterium tuberculosis H37Rv	Mycobacterium vanbaalenii PYR-1	Predicted erythritol ABC transporter 1, ATP-binding protein
MSMEG_3270	Mycobacterium abscessus ATCC 19977	Mycobacterium avium 104	Mycobacterium flavescens PYR-GCK	Mycobacterium leprae TN	Mycobacterium marinum M	Mycobacterium smegmatis str. MC2 155 Gene: MSMEG_3270: Predicted erythritol ABC transporter 1, ATP-binding protein	Mycobacterium sp. JLS Gene: Mjls_2598: Predicted erythritol ABC transporter 1, ATP-binding protein	Mycobacterium tuberculosis H37Rv	Mycobacterium vanbaalenii PYR-1	Predicted erythritol ABC transporter 1, ATP-binding protein
MSMEG_3271	Mycobacterium abscessus ATCC 19977	Mycobacterium avium 104	Mycobacterium flavescens PYR-GCK	Mycobacterium leprae TN	Mycobacterium marinum M	Mycobacterium smegmatis str. MC2 155 Gene: MSMEG_3271: D-erythrulose kinase	Mycobacterium sp. JLS Gene: Mjls_2599: D-erythrulose kinase	Mycobacterium tuberculosis H37Rv	Mycobacterium vanbaalenii PYR-1	D-erythrulose kinase
MSMEG_3272	Mycobacterium abscessus ATCC 19977	Mycobacterium avium 104	Mycobacterium flavescens PYR-GCK	Mycobacterium leprae TN	Mycobacterium marinum M	Mycobacterium smegmatis str. MC2 155 Gene: MSMEG_3272: D-erythrulose 4-phosphate isomerase	Mycobacterium sp. JLS Gene: Mjls_2600: D-erythrulose 4-phosphate isomerase	Mycobacterium tuberculosis H37Rv	Mycobacterium vanbaalenii PYR-1	D-erythrulose 4-phosphate isomerase

Export

	Regulated Genes	[ Tab delimited format ]	DOWNLOAD
	Regulatory Sites	[ FASTA format ]	DOWNLOAD