Regulog MSMEG_3264 - Mycobacteriaceae
| Regulator type: | Transcription factor |
| Regulator family: | DeoR |
| Regulation mode: | |
| Biological process: | Erythritol utilization; D-threitol utilization |
| Effector: | |
| Phylum: | Actinobacteria |
| Visualization: | |
|
Allows to visualize regulog content in the context of metabolic pathways |
Member of regulog collections
- By taxonomy - Mycobacteriaceae
- By TF family - DeoR
- By pathway - Erythritol utilization
- By pathway - D-threitol utilization
| Genome | Genes | Operons |
|---|---|---|
| Mycobacterium abscessus ATCC 19977 | ||
| Mycobacterium avium 104 | ||
| Mycobacterium flavescens PYR-GCK | ||
| Mycobacterium leprae TN | ||
| Mycobacterium marinum M | ||
| Mycobacterium smegmatis str. MC2 155 | 10 | 2 |
| Mycobacterium sp. JLS | 9 | 2 |
| Mycobacterium tuberculosis H37Rv | ||
| Mycobacterium vanbaalenii PYR-1 |
| Genes | Function | |||||||||
|---|---|---|---|---|---|---|---|---|---|---|
| CRON 1. | ||||||||||
| MSMEG_3264 |
|
|
|
|
|
*
Mycobacterium smegmatis str. MC2 155 Site: position = -71 score = 5.41305 sequence = TGCACAATTGTCCAGAACATCTGTTCA Gene: MSMEG_3264: Transcriptional regulator for D-threitol and erythritol utilization, DeoR family |
*
Mycobacterium sp. JLS Site: position = -73 score = 5.32948 sequence = TGCACATCTGTCCAGAACATCTGTTCA Site: position = -60 score = 4.5204 sequence = AGAACATCTGTTCAGGGAGAATCTGTT Gene: Mjls_2592: Transcriptional regulator for D-threitol and erythritol utilization, DeoR family |
|
|
Transcriptional regulator for D-threitol and erythritol utilization, DeoR family |
| MSMEG_3262 |
|
|
|
|
|
Gene: MSMEG_3262: oxidoreductase, short-chain dehydrogenase-reductase family (kduD) |
|
|
|
oxidoreductase, short-chain dehydrogenase-reductase family |
| CRON 2. | ||||||||||
| MSMEG_3265 |
|
|
|
|
|
*
Mycobacterium smegmatis str. MC2 155 Site: position = -74 score = 7.63115 sequence = TGAACAGATGTTCTGGACAATTGTGCA Gene: MSMEG_3265: homolog of sorbitol dehydrogenase |
*
Mycobacterium sp. JLS Site: position = -71 score = 7.98138 sequence = TGAACAGATGTTCTGGACAGATGTGCA Gene: Mjls_2593: homolog of sorbitol dehydrogenase |
|
|
homolog of sorbitol dehydrogenase |
| MSMEG_3266 |
|
|
|
|
|
Gene: MSMEG_3266: Predicted erythritol ABC transporter 1, substrate-binding component |
Gene: Mjls_2594: Predicted erythritol ABC transporter 1, substrate-binding component |
|
|
Predicted erythritol ABC transporter 1, substrate-binding component |
| MSMEG_3267 |
|
|
|
|
|
Gene: MSMEG_3267: Predicted erythritol ABC transporter, permease protein |
Gene: Mjls_2595: Predicted erythritol ABC transporter, permease protein |
|
|
Predicted erythritol ABC transporter, permease protein |
| MSMEG_3268 |
|
|
|
|
|
Gene: MSMEG_3268: Predicted erythritol ABC transporter, permease protein |
Gene: Mjls_2596: Predicted erythritol ABC transporter, permease protein |
|
|
Predicted erythritol ABC transporter, permease protein |
| MSMEG_3269 |
|
|
|
|
|
Gene: MSMEG_3269: Predicted erythritol ABC transporter 1, ATP-binding protein |
Gene: Mjls_2597: Predicted erythritol ABC transporter 1, ATP-binding protein |
|
|
Predicted erythritol ABC transporter 1, ATP-binding protein |
| MSMEG_3270 |
|
|
|
|
|
Gene: MSMEG_3270: Predicted erythritol ABC transporter 1, ATP-binding protein |
Gene: Mjls_2598: Predicted erythritol ABC transporter 1, ATP-binding protein |
|
|
Predicted erythritol ABC transporter 1, ATP-binding protein |
| MSMEG_3271 |
|
|
|
|
|
Gene: MSMEG_3271: D-erythrulose kinase |
Gene: Mjls_2599: D-erythrulose kinase |
|
|
D-erythrulose kinase |
| MSMEG_3272 |
|
|
|
|
|
Gene: MSMEG_3272: D-erythrulose 4-phosphate isomerase |
Gene: Mjls_2600: D-erythrulose 4-phosphate isomerase |
|
|
D-erythrulose 4-phosphate isomerase |
Bluish color - the gene is in regulated operon. Different regulated operons are shown in different shades of blue.
Red color - the gene is in non-regulated operon.
Gray color - the orthologous gene is absent.
The star symbol - the TFBS is located in upstream region of this gene.
The number - the numeber of homologs (shown only if it is greater than one).
|
Regulated Genes | [ Tab delimited format ] | DOWNLOAD |
|
Regulatory Sites | [ FASTA format ] | DOWNLOAD |