Regulon of MSMEG_3264 in Mycobacterium smegmatis str. MC2 155

Properties
Regulator type:	Transcription factor
TF locus tag:	MSMEG_3264
Regulator family:	DeoR
Regulation mode:
Biological process:	Erythritol utilization; D-threitol utilization
Effector:
Regulog:	MSMEG_3264 - Mycobacteriaceae
Statistics of regulated genes:
- Genes	10
- Operons	2
Visualization:
	Allows to visualize regulon content in the context of metabolic pathways

Built upon 5 sites [see more]

Member of regulog collections

By taxonomy - Mycobacteriaceae
By TF family - DeoR
By pathway - Erythritol utilization
By pathway - D-threitol utilization

Regulated operons
	Locus Tag	Name	Function
Position: -74 Score: 7.6 Sequence: TGAACAGATGTTCTGGACAATTGTGCA Locus tag: MSMEG_3265 Name: MSMEG_3265 Funciton: homolog of sorbitol dehydrogenase Locus tag: MSMEG_3266 Name: MSMEG_3266 Funciton: Predicted erythritol ABC transporter 1, substrate-binding component Locus tag: MSMEG_3267 Name: MSMEG_3267 Funciton: Predicted erythritol ABC transporter, permease protein Locus tag: MSMEG_3268 Name: MSMEG_3268 Funciton: Predicted erythritol ABC transporter, permease protein Locus tag: MSMEG_3269 Name: MSMEG_3269 Funciton: Predicted erythritol ABC transporter 1, ATP-binding protein Locus tag: MSMEG_3270 Name: MSMEG_3270 Funciton: Predicted erythritol ABC transporter 1, ATP-binding protein Locus tag: MSMEG_3271 Name: MSMEG_3271 Funciton: D-erythrulose kinase Locus tag: MSMEG_3272 Name: MSMEG_3272 Funciton: D-erythrulose 4-phosphate isomerase
	MSMEG_3265	MSMEG_3265	homolog of sorbitol dehydrogenase
	MSMEG_3266	MSMEG_3266	Predicted erythritol ABC transporter 1, substrate-binding component
	MSMEG_3267	MSMEG_3267	Predicted erythritol ABC transporter, permease protein
	MSMEG_3268	MSMEG_3268	Predicted erythritol ABC transporter, permease protein
	MSMEG_3269	MSMEG_3269	Predicted erythritol ABC transporter 1, ATP-binding protein
	MSMEG_3270	MSMEG_3270	Predicted erythritol ABC transporter 1, ATP-binding protein
	MSMEG_3271	MSMEG_3271	D-erythrulose kinase
	MSMEG_3272	MSMEG_3272	D-erythrulose 4-phosphate isomerase
Position: -71 Score: 5.4 Sequence: TGCACAATTGTCCAGAACATCTGTTCA Locus tag: MSMEG_3264 Name: MSMEG_3264 Funciton: Transcriptional regulator for D-threitol and erythritol utilization, DeoR family Locus tag: MSMEG_3262 Name: MSMEG_3262 Funciton: oxidoreductase, short-chain dehydrogenase-reductase family (kduD)
	MSMEG_3264	MSMEG_3264	Transcriptional regulator for D-threitol and erythritol utilization, DeoR family
	MSMEG_3262	MSMEG_3262	oxidoreductase, short-chain dehydrogenase-reductase family (kduD)

Export
	Regulated Genes	[ Tab delimited format ]	DOWNLOAD
	Regulatory Sites	[ FASTA format ]	DOWNLOAD