Regulon of MSMEG_3264 in Mycobacterium sp. JLS

Properties
Regulator type:	Transcription factor
TF locus tag:	Mjls_2592
Regulator family:	DeoR
Regulation mode:
Biological process:	Erythritol utilization; D-threitol utilization
Effector:
Regulog:	MSMEG_3264 - Mycobacteriaceae
Statistics of regulated genes:
- Genes	9
- Operons	2
Visualization:
	Allows to visualize regulon content in the context of metabolic pathways

Built upon 5 sites [see more]

Member of regulog collections

By taxonomy - Mycobacteriaceae
By TF family - DeoR
By pathway - Erythritol utilization
By pathway - D-threitol utilization

Regulated operons
	Locus Tag	Name	Function
Position: -73 Score: 5.3 Sequence: TGCACATCTGTCCAGAACATCTGTTCA Position: -60 Score: 4.5 Sequence: AGAACATCTGTTCAGGGAGAATCTGTT Locus tag: Mjls_2592 Name: MSMEG_3264 Funciton: Transcriptional regulator for D-threitol and erythritol utilization, DeoR family
	Mjls_2592	MSMEG_3264	Transcriptional regulator for D-threitol and erythritol utilization, DeoR family
Position: -71 Score: 8 Sequence: TGAACAGATGTTCTGGACAGATGTGCA Locus tag: Mjls_2593 Name: MSMEG_3265 Funciton: homolog of sorbitol dehydrogenase Locus tag: Mjls_2594 Name: MSMEG_3266 Funciton: Predicted erythritol ABC transporter 1, substrate-binding component Locus tag: Mjls_2595 Name: MSMEG_3267 Funciton: Predicted erythritol ABC transporter, permease protein Locus tag: Mjls_2596 Name: MSMEG_3268 Funciton: Predicted erythritol ABC transporter, permease protein Locus tag: Mjls_2597 Name: MSMEG_3269 Funciton: Predicted erythritol ABC transporter 1, ATP-binding protein Locus tag: Mjls_2598 Name: MSMEG_3270 Funciton: Predicted erythritol ABC transporter 1, ATP-binding protein Locus tag: Mjls_2599 Name: MSMEG_3271 Funciton: D-erythrulose kinase Locus tag: Mjls_2600 Name: MSMEG_3272 Funciton: D-erythrulose 4-phosphate isomerase
	Mjls_2593	MSMEG_3265	homolog of sorbitol dehydrogenase
	Mjls_2594	MSMEG_3266	Predicted erythritol ABC transporter 1, substrate-binding component
	Mjls_2595	MSMEG_3267	Predicted erythritol ABC transporter, permease protein
	Mjls_2596	MSMEG_3268	Predicted erythritol ABC transporter, permease protein
	Mjls_2597	MSMEG_3269	Predicted erythritol ABC transporter 1, ATP-binding protein
	Mjls_2598	MSMEG_3270	Predicted erythritol ABC transporter 1, ATP-binding protein
	Mjls_2599	MSMEG_3271	D-erythrulose kinase
	Mjls_2600	MSMEG_3272	D-erythrulose 4-phosphate isomerase

Export
	Regulated Genes	[ Tab delimited format ]	DOWNLOAD
	Regulatory Sites	[ FASTA format ]	DOWNLOAD