Regulog BBNG_01789 - Bifidobacteriaceae

Member of regulog collections
- By taxonomy - Bifidobacteriaceae
- By TF family - LacI
- By pathway - Carbohydrate metabolism
Genome | Genes | Operons |
---|---|---|
Bifidobacterium longum subsp. infantis ATCC 15697 | ||
Bifidobacterium adolescentis ATCC 15703 | ||
Bifidobacterium angulatum DSM 20098 | ||
Bifidobacterium animalis subsp. lactis AD011 | ||
Bifidobacterium bifidum NCIMB 41171 | 3 | 2 |
Bifidobacterium breve DSM 20213 | ||
Bifidobacterium dentium Bd1 | ||
Bifidobacterium gallicum DSM 20093 | ||
Bifidobacterium longum NCC2705 | ||
Gardnerella vaginalis 409-05 |
Genes | Function | ||||||||||
---|---|---|---|---|---|---|---|---|---|---|---|
CRON 1. | |||||||||||
BBNG_01789 |
|
|
|
|
*
Bifidobacterium bifidum NCIMB 41171 Site: position = -260 score = 5.2552 sequence = CCTTGTAACCGTTTACATCA Gene: BbifN4_010100009055: Predicted transcription regulator of carbohydrate utilization, lacI family |
|
|
|
|
|
Predicted transcription regulator of carbohydrate utilization, lacI family |
GH43 |
|
|
|
|
Gene: BbifN4_010100009050: Putative alpha-L-arabinofuranosidase, GH43 family |
|
Gene: BDP_2106: Putative alpha-L-arabinofuranosidase, GH43 family |
|
|
|
Putative alpha-L-arabinofuranosidase, GH43 family |
CRON 2. | |||||||||||
BbifN4_010100009055 |
|
|
|
|
*
Bifidobacterium bifidum NCIMB 41171 Site: position = -260 score = 5.2552 sequence = CCTTGTAACCGTTTACATCA Gene: BbifN4_010100009055: Transcription regulator, LacI family |
|
|
|
|
|
Transcription regulator, LacI family |
Bluish color - the gene is in regulated operon. Different regulated operons are shown in different shades of blue.
Red color - the gene is in non-regulated operon.
Gray color - the orthologous gene is absent.
The star symbol - the TFBS is located in upstream region of this gene.
The number - the numeber of homologs (shown only if it is greater than one).
![]() |
Regulated Genes | [ Tab delimited format ] | DOWNLOAD |
![]() |
Regulatory Sites | [ FASTA format ] | DOWNLOAD |