Regulog FucR - Bifidobacteriaceae
| Regulator type: | Transcription factor |
| Regulator family: | LacI |
| Regulation mode: | |
| Biological process: | Fucose utilization |
| Effector: | Fucose |
| Phylum: | Actinobacteria |
| Visualization: | |
|
Allows to visualize regulog content in the context of metabolic pathways |
Member of regulog collections
- By taxonomy - Bifidobacteriaceae
- By TF family - LacI
- By effector - Fucose
- By pathway - Fucose utilization
| Genome | Genes | Operons |
|---|---|---|
| Bifidobacterium longum subsp. infantis ATCC 15697 | 5 | 2 |
| Bifidobacterium adolescentis ATCC 15703 | ||
| Bifidobacterium angulatum DSM 20098 | ||
| Bifidobacterium animalis subsp. lactis AD011 | ||
| Bifidobacterium bifidum NCIMB 41171 | ||
| Bifidobacterium breve DSM 20213 | 2 | 2 |
| Bifidobacterium dentium Bd1 | ||
| Bifidobacterium gallicum DSM 20093 | ||
| Bifidobacterium longum NCC2705 | ||
| Gardnerella vaginalis 409-05 |
| Genes | Function | ||||||||||
|---|---|---|---|---|---|---|---|---|---|---|---|
| CRON 1. | |||||||||||
| fucD |
*
Bifidobacterium longum subsp. infantis ATCC 15697 Site: position = -87 score = 5.29717 sequence = AAAAATTTTCGTAATCGGGT Gene: Blon_2309: L-fuconate dehydratase (EC 4.2.1.68) |
|
|
|
|
*
Bifidobacterium breve DSM 20213 Site: position = -88 score = 5.00083 sequence = AAAAATTTTCGCAAATAGGC Gene: BIFBRE_00138: L-fuconate dehydratase (EC 4.2.1.68) |
|
|
|
|
L-fuconate dehydratase (EC 4.2.1.68) |
| fucO |
Gene: Blon_2308: Potentail L-fucose dehydrogenase |
|
|
|
|
Gene: BIFBRE_00140: Potentail L-fucose dehydrogenase |
|
|
|
|
Potentail L-fucose dehydrogenase |
| fucP |
Gene: Blon_2307: Potential L-fucose permease |
|
|
|
|
Gene: BIFBRE_00141: Potential L-fucose permease |
|
|
|
|
Potential L-fucose permease |
| fucL |
Gene: Blon_2306: Potential L-fucono-1,5-lactonase |
|
|
|
|
Gene: BIFBRE_00143: Potential L-fucono-1,5-lactonase |
|
|
|
|
Potential L-fucono-1,5-lactonase |
| CRON 2. | |||||||||||
| fucR |
*
Bifidobacterium longum subsp. infantis ATCC 15697 Site: position = -112 score = 5.29717 sequence = ACCCGATTACGAAAATTTTT Gene: Blon_2310: Transcriptional regulator of L-fucose utilization, LacI family |
|
|
|
|
*
Bifidobacterium breve DSM 20213 Site: position = 79 score = 5.00083 sequence = GCCTATTTGCGAAAATTTTT Gene: BIFBRE_00139: Transcriptional regulator of L-fucose utilization, LacI family |
|
|
|
|
Transcriptional regulator of L-fucose utilization, LacI family |
Bluish color - the gene is in regulated operon. Different regulated operons are shown in different shades of blue.
Red color - the gene is in non-regulated operon.
Gray color - the orthologous gene is absent.
The star symbol - the TFBS is located in upstream region of this gene.
The number - the numeber of homologs (shown only if it is greater than one).
|
Regulated Genes | [ Tab delimited format ] | DOWNLOAD |
|
Regulatory Sites | [ FASTA format ] | DOWNLOAD |