Regulog GlvR - Staphylococcaceae

Properties
Regulator type:	Transcription factor
Regulator family:	RpiR
Regulation mode:	activator
Biological process:	Maltose utilization
Effector:	Maltose-6-phosphate
Phylum:	Firmicutes
Visualization:
	Allows to visualize regulog content in the context of metabolic pathways

Built upon 5 sites [see more]

Member of regulog collections

Statistics of regulated genes
Genome	Genes	Operons
Staphylococcus aureus subsp. aureus N315	1	1
Staphylococcus capitis SK14	1	1
Staphylococcus epidermidis ATCC 12228	1	1
Staphylococcus carnosus subsp. carnosus TM300
Staphylococcus haemolyticus JCSC1435	1	1
Staphylococcus saprophyticus subsp. saprophyticus ATCC 15305	1	1
Macrococcus caseolyticus JCSC5402

Clusters of co-Regulated Orthologous operoNs (CRONs)
Genes								Function

CRON 1.
glvC	* Staphylococcus aureus subsp. aureus N315 Site: position = -181 score = 7.60113 sequence = TGAAAAAATTTTCACTATATGAAAA Gene: SA2114: maltose-specific PTS system, IIBC component	* Staphylococcus capitis SK14 Site: position = -190 score = 7.26727 sequence = TGAAAAAATTTCCGTTCAATGAAAA Gene: STACA0001_1166: maltose-specific PTS system, IIBC component	* Staphylococcus epidermidis ATCC 12228 Site: position = -181 score = 7.60113 sequence = TGAAAATATTTTCTTTATATGAAAA Gene: SE1897: maltose-specific PTS system, IIBC component	Staphylococcus carnosus subsp. carnosus TM300	* Staphylococcus haemolyticus JCSC1435 Site: position = -198 score = 7.36289 sequence = TGAAAATATTTTCATGTATAGAAAA Gene: SH0732: maltose-specific PTS system, IIBC component	* Staphylococcus saprophyticus subsp. saprophyticus ATCC 15305 Site: position = -193 score = 7.39881 sequence = TGAAAATATTTTCAACTTTTGAAAA Gene: SSP0583: maltose-specific PTS system, IIBC component	Macrococcus caseolyticus JCSC5402	maltose-specific PTS system, IIBC component

Bluish color - the gene is in regulated operon. Different regulated operons are shown in different shades of blue.

Red color - the gene is in non-regulated operon.

Gray color - the orthologous gene is absent.

The star symbol - the TFBS is located in upstream region of this gene.

The number - the numeber of homologs (shown only if it is greater than one).

Export
	Regulated Genes	[ Tab delimited format ]	DOWNLOAD
	Regulatory Sites	[ FASTA format ]	DOWNLOAD

Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes -- version 3.2 --