Regulog GlvR - Staphylococcaceae
| Regulator type: | Transcription factor |
| Regulator family: | RpiR |
| Regulation mode: | activator |
| Biological process: | Maltose utilization |
| Effector: | Maltose-6-phosphate |
| Phylum: | Firmicutes |
| Visualization: | |
|
Allows to visualize regulog content in the context of metabolic pathways |
Member of regulog collections
- By taxonomy - Staphylococcaceae
- By TF family - RpiR
- By effector - Maltose-6-phosphate
- By pathway - Maltose utilization
| Genome | Genes | Operons |
|---|---|---|
| Staphylococcus aureus subsp. aureus N315 | 1 | 1 |
| Staphylococcus capitis SK14 | 1 | 1 |
| Staphylococcus epidermidis ATCC 12228 | 1 | 1 |
| Staphylococcus carnosus subsp. carnosus TM300 | ||
| Staphylococcus haemolyticus JCSC1435 | 1 | 1 |
| Staphylococcus saprophyticus subsp. saprophyticus ATCC 15305 | 1 | 1 |
| Macrococcus caseolyticus JCSC5402 |
| Genes | Function | |||||||
|---|---|---|---|---|---|---|---|---|
| CRON 1. | ||||||||
| glvC |
*
Staphylococcus aureus subsp. aureus N315 Site: position = -181 score = 7.60113 sequence = TGAAAAAATTTTCACTATATGAAAA Gene: SA2114: maltose-specific PTS system, IIBC component |
*
Staphylococcus capitis SK14 Site: position = -190 score = 7.26727 sequence = TGAAAAAATTTCCGTTCAATGAAAA Gene: STACA0001_1166: maltose-specific PTS system, IIBC component |
*
Staphylococcus epidermidis ATCC 12228 Site: position = -181 score = 7.60113 sequence = TGAAAATATTTTCTTTATATGAAAA Gene: SE1897: maltose-specific PTS system, IIBC component |
|
*
Staphylococcus haemolyticus JCSC1435 Site: position = -198 score = 7.36289 sequence = TGAAAATATTTTCATGTATAGAAAA Gene: SH0732: maltose-specific PTS system, IIBC component |
*
Staphylococcus saprophyticus subsp. saprophyticus ATCC 15305 Site: position = -193 score = 7.39881 sequence = TGAAAATATTTTCAACTTTTGAAAA Gene: SSP0583: maltose-specific PTS system, IIBC component |
|
maltose-specific PTS system, IIBC component |
Bluish color - the gene is in regulated operon. Different regulated operons are shown in different shades of blue.
Red color - the gene is in non-regulated operon.
Gray color - the orthologous gene is absent.
The star symbol - the TFBS is located in upstream region of this gene.
The number - the numeber of homologs (shown only if it is greater than one).
|
Regulated Genes | [ Tab delimited format ] | DOWNLOAD |
|
Regulatory Sites | [ FASTA format ] | DOWNLOAD |