Regulon of GlvR in Staphylococcus epidermidis ATCC 12228
| Regulator type: | Transcription factor |
| TF locus tag: | SE1898 |
| Regulator family: | RpiR |
| Regulation mode: | activator |
| Biological process: | Maltose utilization |
| Effector: | Maltose-6-phosphate |
| Regulog: | GlvR - Staphylococcaceae |
| Statistics of regulated genes: | |
| - Genes | 1 |
| - Operons | 1 |
| Visualization: | |
|
Allows to visualize regulon content in the context of metabolic pathways |
Member of regulog collections
- By taxonomy - Staphylococcaceae
- By TF family - RpiR
- By effector - Maltose-6-phosphate
- By pathway - Maltose utilization
| Locus Tag | Name | Function | |
|---|---|---|---|
|
Position: -181
Score: 7.6 Sequence: TGAAAATATTTTCTTTATATGAAAA
Locus tag: SE1897
Name: glvC Funciton: maltose-specific PTS system, IIBC component |
|||
|
glvC
|
maltose-specific PTS system, IIBC component
|
||
|
Regulated Genes | [ Tab delimited format ] | DOWNLOAD |
|
Regulatory Sites | [ FASTA format ] | DOWNLOAD |