Regulon of GlvR in Staphylococcus epidermidis ATCC 12228

Properties
Regulator type:	Transcription factor
TF locus tag:	SE1898
Regulator family:	RpiR
Regulation mode:	activator
Biological process:	Maltose utilization
Effector:	Maltose-6-phosphate
Regulog:	GlvR - Staphylococcaceae
Statistics of regulated genes:
- Genes	1
- Operons	1
Visualization:
	Allows to visualize regulon content in the context of metabolic pathways

Built upon 5 sites [see more]

Member of regulog collections

By taxonomy - Staphylococcaceae
By TF family - RpiR
By effector - Maltose-6-phosphate
By pathway - Maltose utilization

Regulated operons
	Locus Tag	Name	Function
Position: -181 Score: 7.6 Sequence: TGAAAATATTTTCTTTATATGAAAA Locus tag: SE1897 Name: glvC Funciton: maltose-specific PTS system, IIBC component
	SE1897	glvC	maltose-specific PTS system, IIBC component

Export
	Regulated Genes	[ Tab delimited format ]	DOWNLOAD
	Regulatory Sites	[ FASTA format ]	DOWNLOAD