Regulon of GlvR in Staphylococcus saprophyticus subsp. saprophyticus ATCC 15305

Properties
Regulator type:	Transcription factor
TF locus tag:	SSP0582
Regulator family:	RpiR
Regulation mode:	activator
Biological process:	Maltose utilization
Effector:	Maltose-6-phosphate
Regulog:	GlvR - Staphylococcaceae
Statistics of regulated genes:
- Genes	1
- Operons	1
Visualization:
	Allows to visualize regulon content in the context of metabolic pathways

Built upon 5 sites [see more]

Member of regulog collections

By taxonomy - Staphylococcaceae
By TF family - RpiR
By effector - Maltose-6-phosphate
By pathway - Maltose utilization

Regulated operons
	Locus Tag	Name	Function
Position: -193 Score: 7.4 Sequence: TGAAAATATTTTCAACTTTTGAAAA Locus tag: SSP0583 Name: glvC Funciton: maltose-specific PTS system, IIBC component
	SSP0583	glvC	maltose-specific PTS system, IIBC component

Export
	Regulated Genes	[ Tab delimited format ]	DOWNLOAD
	Regulatory Sites	[ FASTA format ]	DOWNLOAD