Regulog CzrA - Clostridia-1
| Regulator type: | Transcription factor |
| Regulator family: | ArsR |
| Regulation mode: | repressor |
| Biological process: | Zinc resistance; Nickel resistance; Copper resistance; Cobalt resistance; Cadmium resistance |
| Effector: | Zinc ion, (Zn2+); Silver ion, (Ag+); Nickel ion, (Ni2+); Copper ion, (Cu2+); Cobalt ion, (Co2+); Cadmium, ion (Cd2+) |
| Phylum: | Firmicutes |
| Visualization: | |
|
Allows to visualize regulog content in the context of metabolic pathways |
Member of regulog collections
- By taxonomy - Clostridia-1
- By trascription factor - CzrA
- By TF family - ArsR
- By effector - Zinc ion, (Zn2+)
- By effector - Silver ion, (Ag+)
- By effector - Nickel ion, (Ni2+)
- By effector - Copper ion, (Cu2+)
- By effector - Cobalt ion, (Co2+)
- By effector - Cadmium, ion (Cd2+)
- By pathway - Zinc resistance
- By pathway - Nickel resistance
- By pathway - Copper resistance
- By pathway - Cobalt resistance
- By pathway - Cadmium resistance
| Genome | Genes | Operons |
|---|---|---|
| Clostridium acetobutylicum ATCC 824 | 2 | 1 |
| Clostridium beijerincki NCIMB 8052 | 2 | 1 |
| Clostridium botulinum A str. ATCC 3502 | 2 | 1 |
| Clostridium butyricum 5521 | 2 | 1 |
| Clostridium kluyveri DSM 555 | 1 | 1 |
| Clostridium novyi NT | 2 | 1 |
| Clostridium perfringens ATCC 13124 | 2 | 1 |
| Clostridium tetani E88 |
| Genes | Function | ||||||||
|---|---|---|---|---|---|---|---|---|---|
| CRON 1. | |||||||||
| czrA |
*
Clostridium acetobutylicum ATCC 824 Site: position = -45 score = 7.38741 sequence = CATATGAACATATATTCATATG Gene: CAC2242: Transcriptional repressor of multiple metal-sensing, ArsR family |
*
Clostridium beijerincki NCIMB 8052 Site: position = -44 score = 6.91187 sequence = CGTATGAACAGATATTCATATG Gene: Cbei_1448: Transcriptional repressor of multiple metal-sensing, ArsR family |
*
Clostridium botulinum A str. ATCC 3502 Site: position = -68 score = 6.7498 sequence = CATATGAACAATTATTCATACG Gene: CBO0477: Transcriptional repressor of multiple metal-sensing, ArsR family |
*
Clostridium butyricum 5521 Site: position = -41 score = 7.14698 sequence = CATATGAACAGATGCTCATATG Gene: CBY_3037: Transcriptional repressor of multiple metal-sensing, ArsR family |
2
Clostridium kluyveri DSM 555 Gene: CKL_3755: Transcriptional repressor of multiple metal-sensing, ArsR family Gene: CKL_3732: Transcriptional repressor of multiple metal-sensing, ArsR family |
*
Clostridium novyi NT Site: position = -35 score = 7.07394 sequence = CATATGAATATATGTTCAAATG Gene: NT01CX_1198: Transcriptional repressor of multiple metal-sensing, ArsR family |
*
Clostridium perfringens ATCC 13124 Site: position = -49 score = 7.14698 sequence = CATATGAACAGATGCTCATATG Gene: CPF_2588: Transcriptional repressor of multiple metal-sensing, ArsR family |
|
Transcriptional repressor of multiple metal-sensing, ArsR family |
| cadA |
Gene: CAC2241: Cadmium-transporting ATPase (EC 3.6.3.3) |
Gene: Cbei_1449: Cadmium-transporting ATPase (EC 3.6.3.3) |
Gene: CBO0478: Cadmium-transporting ATPase (EC 3.6.3.3) |
Gene: CBY_3038: Cadmium-transporting ATPase (EC 3.6.3.3) |
*
Clostridium kluyveri DSM 555 Site: position = -159 score = 6.33438 sequence = CATATGAACAATAACTCATATG Gene: CKL_2303: Cadmium-transporting ATPase (EC 3.6.3.3) |
Gene: NT01CX_1199: Cadmium-transporting ATPase (EC 3.6.3.3) |
Gene: CPF_2587: Cadmium-transporting ATPase (EC 3.6.3.3) |
Gene: CTC01955: Cadmium-transporting ATPase (EC 3.6.3.3) |
Cadmium-transporting ATPase (EC 3.6.3.3) |
Bluish color - the gene is in regulated operon. Different regulated operons are shown in different shades of blue.
Red color - the gene is in non-regulated operon.
Gray color - the orthologous gene is absent.
The star symbol - the TFBS is located in upstream region of this gene.
The number - the numeber of homologs (shown only if it is greater than one).
|
Regulated Genes | [ Tab delimited format ] | DOWNLOAD |
|
Regulatory Sites | [ FASTA format ] | DOWNLOAD |