Regulog EutR - Rhizobiales
| Regulator type: | Transcription factor |
| Regulator family: | RpiR |
| Regulation mode: | |
| Biological process: | Ethanolamine utilization |
| Effector: | Ethanolamine |
| Phylum: | Proteobacteria/Alpha |
| Visualization: | |
|
Allows to visualize regulog content in the context of metabolic pathways |
Member of regulog collections
- By taxonomy - Rhizobiales
- By TF family - RpiR
- By effector - Ethanolamine
- By pathway - Ethanolamine utilization
| Genome | Genes | Operons |
|---|---|---|
| Agrobacterium tumefaciens str. C58 (Cereon) | 8 | 2 |
| Azorhizobium caulinodans ORS 571 | ||
| Bartonella quintana str. Toulouse | ||
| Bradyrhizobium japonicum USDA 110 | ||
| Bradyrhizobium sp. BTAi1 | ||
| Brucella melitensis 16M | ||
| Mesorhizobium loti MAFF303099 | ||
| Mesorhizobium sp. BNC1 | 5 | 2 |
| Nitrobacter winogradskyi Nb-255 | ||
| Rhizobium etli CFN 42 | 6 | 2 |
| Rhizobium leguminosarum bv. viciae 3841 | 6 | 2 |
| Rhizobium sp. NGR234 | 6 | 2 |
| Rhodopseudomonas palustris CGA009 | ||
| Sinorhizobium meliloti 1021 | 6 | 2 |
| Xanthobacter autotrophicus Py2 |
| Genes | Function | |||||||||||||||
|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
| CRON 1. | ||||||||||||||||
| eutR |
*
Agrobacterium tumefaciens str. C58 (Cereon) Site: position = -94 score = 5.10291 sequence = TTTGAAATTTTCTCTTCATT Site: position = -136 score = 5.05214 sequence = GACGAAAAGAATTCTTCACA Gene: Atu2145: Transcriptional regulator of ethanolamine utilization, RpiR family |
|
|
|
|
|
|
*
Mesorhizobium sp. BNC1 Site: position = -123 score = 4.53296 sequence = TTTGAAATTAATCATTCAGA Site: position = -81 score = 5.41718 sequence = TTTGAAAAATTCTCTTCACC Gene: Meso_1872: Transcriptional regulator of ethanolamine utilization, RpiR family |
|
*
Rhizobium etli CFN 42 Site: position = -32 score = 5.85013 sequence = TCTGAAAATTTCTTTTCATG Site: position = -74 score = 5.31833 sequence = TAAGAAAAGAATTCTTCAGG Gene: RHE_CH02889: Transcriptional regulator of ethanolamine utilization, RpiR family |
*
Rhizobium leguminosarum bv. viciae 3841 Site: position = -144 score = 5.04026 sequence = GAAGAAAAGAATTCTTCAGG Site: position = -102 score = 5.692 sequence = ACTGAAAATTTCTTTTCATG Gene: RL3349: Transcriptional regulator of ethanolamine utilization, RpiR family |
*
Rhizobium sp. NGR234 Site: position = -136 score = 5.66532 sequence = CGTGAAAAGAATTCTTCACG Site: position = -94 score = 5.7199 sequence = TCTGAAACGATCTTTTCAGT Gene: NGR_c21480: Transcriptional regulator of ethanolamine utilization, RpiR family |
|
*
Sinorhizobium meliloti 1021 Site: position = -137 score = 5.58848 sequence = TGTGAAGAGAATTCTTCACG Site: position = -95 score = 5.57718 sequence = ACTGAAACGATCTTTTCAAA Gene: SMc01602: Transcriptional regulator of ethanolamine utilization, RpiR family |
|
Transcriptional regulator of ethanolamine utilization, RpiR family |
| CRON 2. | ||||||||||||||||
| eutA |
*
Agrobacterium tumefaciens str. C58 (Cereon) Site: position = -56 score = 5.05214 sequence = TGTGAAGAATTCTTTTCGTC Site: position = -98 score = 5.10291 sequence = AATGAAGAGAAAATTTCAAA Gene: Atu2144: putative N-formylglutamate amidohydrolase family protein |
|
|
|
|
|
|
*
Mesorhizobium sp. BNC1 Site: position = -89 score = 5.41718 sequence = GGTGAAGAGAATTTTTCAAA Site: position = -47 score = 4.53296 sequence = TCTGAATGATTAATTTCAAA Gene: Meso_1871: putative N-formylglutamate amidohydrolase family protein |
|
*
Rhizobium etli CFN 42 Site: position = -169 score = 5.85013 sequence = CATGAAAAGAAATTTTCAGA Site: position = -127 score = 5.31833 sequence = CCTGAAGAATTCTTTTCTTA Gene: RHE_CH02888: putative N-formylglutamate amidohydrolase family protein |
*
Rhizobium leguminosarum bv. viciae 3841 Site: position = -57 score = 5.04026 sequence = CCTGAAGAATTCTTTTCTTC Site: position = -99 score = 5.692 sequence = CATGAAAAGAAATTTTCAGT Gene: RL3348: putative N-formylglutamate amidohydrolase family protein |
*
Rhizobium sp. NGR234 Site: position = -93 score = 5.7199 sequence = ACTGAAAAGATCGTTTCAGA Site: position = -51 score = 5.66532 sequence = CGTGAAGAATTCTTTTCACG Gene: NGR_c21470: putative N-formylglutamate amidohydrolase family protein |
|
*
Sinorhizobium meliloti 1021 Site: position = -95 score = 5.57718 sequence = TTTGAAAAGATCGTTTCAGT Site: position = -53 score = 5.58848 sequence = CGTGAAGAATTCTCTTCACA Gene: SMc01600: putative N-formylglutamate amidohydrolase family protein |
|
putative N-formylglutamate amidohydrolase family protein |
| eutT |
Gene: Atu2143: Ethanolamine permease, APC family |
|
|
|
Gene: BBta_2262: Ethanolamine permease, APC family |
|
|
|
|
Gene: RHE_CH02887: Ethanolamine permease, APC family |
2
Rhizobium leguminosarum bv. viciae 3841 Gene: RL3347: Ethanolamine permease, APC family Gene: RL4367: Ethanolamine permease, APC family |
Gene: NGR_c21460: Ethanolamine permease, APC family |
|
Gene: SMc01597: Ethanolamine permease, APC family |
|
Ethanolamine permease, APC family |
| eutB |
Gene: Atu2142: glutamine synthetase family protein |
|
|
|
|
|
|
Gene: Meso_1870: glutamine synthetase family protein |
|
Gene: RHE_CH02886: glutamine synthetase family protein |
Gene: RL3346: glutamine synthetase family protein |
Gene: NGR_c21450: glutamine synthetase family protein |
|
Gene: SMc01594: glutamine synthetase family protein |
|
glutamine synthetase family protein |
| Atu2141 |
Gene: Atu2141: hypothetical protein |
|
|
|
|
|
|
|
|
|
|
|
|
|
|
hypothetical protein |
| Atu2140 |
Gene: Atu2140: hypothetical protein |
|
|
|
|
|
|
|
|
|
|
|
|
|
|
hypothetical protein |
| eutX |
Gene: Atu2139: Aldehyde dehydrogenase (EC 1.2.1.3) |
|
|
|
|
|
|
Gene: Meso_1869: Aldehyde dehydrogenase (EC 1.2.1.3) |
|
Gene: RHE_CH02885: Aldehyde dehydrogenase (EC 1.2.1.3) |
Gene: RL3345: Aldehyde dehydrogenase (EC 1.2.1.3) |
Gene: NGR_c21440: Aldehyde dehydrogenase (EC 1.2.1.3) |
|
Gene: SMc01588: Aldehyde dehydrogenase (EC 1.2.1.3) |
|
Aldehyde dehydrogenase (EC 1.2.1.3) |
| eutY |
Gene: Atu2138: Alcohol dehydrogenase (EC 1.1.1.1) |
|
|
|
|
|
|
Gene: Meso_1868: Alcohol dehydrogenase (EC 1.1.1.1) |
|
Gene: RHE_CH02884: Alcohol dehydrogenase (EC 1.1.1.1) |
Gene: RL3344: Alcohol dehydrogenase (EC 1.1.1.1) |
Gene: NGR_c21430: Alcohol dehydrogenase (EC 1.1.1.1) |
|
Gene: SMc01582: Alcohol dehydrogenase (EC 1.1.1.1) |
|
Alcohol dehydrogenase (EC 1.1.1.1) |
Bluish color - the gene is in regulated operon. Different regulated operons are shown in different shades of blue.
Red color - the gene is in non-regulated operon.
Gray color - the orthologous gene is absent.
The star symbol - the TFBS is located in upstream region of this gene.
The number - the numeber of homologs (shown only if it is greater than one).
|
Regulated Genes | [ Tab delimited format ] | DOWNLOAD |
|
Regulatory Sites | [ FASTA format ] | DOWNLOAD |