Regulon of EutR in Sinorhizobium meliloti 1021

Properties
Regulator type:	Transcription factor
TF locus tag:	SMc01602
Regulator family:	RpiR
Regulation mode:
Biological process:	Ethanolamine utilization
Effector:	Ethanolamine
Regulog:	EutR - Rhizobiales
Statistics of regulated genes:
- Genes	6
- Operons	2
Visualization:
	Allows to visualize regulon content in the context of metabolic pathways

Built upon 24 sites [see more]

Member of regulog collections

By taxonomy - Rhizobiales
By TF family - RpiR
By effector - Ethanolamine
By pathway - Ethanolamine utilization

Regulated operons
	Locus Tag	Name	Function
Position: -137 Score: 5.6 Sequence: TGTGAAGAGAATTCTTCACG Position: -95 Score: 5.6 Sequence: ACTGAAACGATCTTTTCAAA Locus tag: SMc01602 Name: eutR Funciton: Transcriptional regulator of ethanolamine utilization, RpiR family
	SMc01602	eutR	Transcriptional regulator of ethanolamine utilization, RpiR family
Position: -95 Score: 5.6 Sequence: TTTGAAAAGATCGTTTCAGT Position: -53 Score: 5.6 Sequence: CGTGAAGAATTCTCTTCACA Locus tag: SMc01600 Name: eutA Funciton: putative N-formylglutamate amidohydrolase family protein Locus tag: SMc01597 Name: eutT Funciton: Ethanolamine permease, APC family Locus tag: SMc01594 Name: eutB Funciton: glutamine synthetase family protein Locus tag: SMc01588 Name: eutX Funciton: Aldehyde dehydrogenase (EC 1.2.1.3) Locus tag: SMc01582 Name: eutY Funciton: Alcohol dehydrogenase (EC 1.1.1.1)
	SMc01600	eutA	putative N-formylglutamate amidohydrolase family protein
	SMc01597	eutT	Ethanolamine permease, APC family
	SMc01594	eutB	glutamine synthetase family protein
	SMc01588	eutX	Aldehyde dehydrogenase (EC 1.2.1.3)
	SMc01582	eutY	Alcohol dehydrogenase (EC 1.1.1.1)

Export
	Regulated Genes	[ Tab delimited format ]	DOWNLOAD
	Regulatory Sites	[ FASTA format ]	DOWNLOAD