Regulon of EutR in Rhizobium leguminosarum bv. viciae 3841

Properties
Regulator type:	Transcription factor
TF locus tag:	RL3349
Regulator family:	RpiR
Regulation mode:
Biological process:	Ethanolamine utilization
Effector:	Ethanolamine
Regulog:	EutR - Rhizobiales
Statistics of regulated genes:
- Genes	6
- Operons	2
Visualization:
	Allows to visualize regulon content in the context of metabolic pathways

Built upon 24 sites [see more]

Member of regulog collections

By taxonomy - Rhizobiales
By TF family - RpiR
By effector - Ethanolamine
By pathway - Ethanolamine utilization

Regulated operons
	Locus Tag	Name	Function
Position: -144 Score: 5 Sequence: GAAGAAAAGAATTCTTCAGG Position: -102 Score: 5.7 Sequence: ACTGAAAATTTCTTTTCATG Locus tag: RL3349 Name: eutR Funciton: Transcriptional regulator of ethanolamine utilization, RpiR family
	RL3349	eutR	Transcriptional regulator of ethanolamine utilization, RpiR family
Position: -99 Score: 5.7 Sequence: CATGAAAAGAAATTTTCAGT Position: -57 Score: 5 Sequence: CCTGAAGAATTCTTTTCTTC Locus tag: RL3348 Name: eutA Funciton: putative N-formylglutamate amidohydrolase family protein Locus tag: RL3347 Name: eutT Funciton: Ethanolamine permease, APC family Locus tag: RL3346 Name: eutB Funciton: glutamine synthetase family protein Locus tag: RL3345 Name: eutX Funciton: Aldehyde dehydrogenase (EC 1.2.1.3) Locus tag: RL3344 Name: eutY Funciton: Alcohol dehydrogenase (EC 1.1.1.1)
	RL3348	eutA	putative N-formylglutamate amidohydrolase family protein
	RL3347	eutT	Ethanolamine permease, APC family
	RL3346	eutB	glutamine synthetase family protein
	RL3345	eutX	Aldehyde dehydrogenase (EC 1.2.1.3)
	RL3344	eutY	Alcohol dehydrogenase (EC 1.1.1.1)

Export
	Regulated Genes	[ Tab delimited format ]	DOWNLOAD
	Regulatory Sites	[ FASTA format ]	DOWNLOAD