Regulog Zur - Enterococcaceae
| Regulator type: | Transcription factor |
| Regulator family: | FUR |
| Regulation mode: | repressor |
| Biological process: | Zinc homeostasis |
| Effector: | Zinc ion, (Zn2+) |
| Phylum: | Firmicutes |
| Visualization: | |
|
Allows to visualize regulog content in the context of metabolic pathways |
Member of regulog collections
- By taxonomy - Enterococcaceae
- By trascription factor - Zur
- By TF family - FUR
- By effector - Zinc ion, (Zn2+)
- By pathway - Zinc homeostasis
| Genome | Genes | Operons |
|---|---|---|
| Enterococcus faecium DO | 8 | 5 |
| Enterococcus faecalis V583 | 16 | 5 |
| Genes | Function | ||
|---|---|---|---|
| CRON 1. | |||
| rpsN2 |
*2
Enterococcus faecium DO Gene: EfaeDRAFT_0071: SSU ribosomal protein S14p Site: position = -55 score = 6.79418 sequence = AAAAGCGTAAAGATTACGATTTA Gene: EfaeDRAFT_0070: SSU ribosomal protein S14p |
*2
Enterococcus faecalis V583 Site: position = -57 score = 7.13691 sequence = CAAATCGTAACCATTACGATTTA Gene: EF3202: SSU ribosomal protein S14p Site: position = -60 score = 6.92532 sequence = CAAAACGTAACGTTTACGATTTG Gene: EF0585: SSU ribosomal protein S14p |
SSU ribosomal protein S14p |
| rpmG2 |
|
2
Enterococcus faecalis V583 Gene: EF0588: LSU ribosomal protein L33p Gene: EF3203: LSU ribosomal protein L33p |
LSU ribosomal protein L33p |
| yciC |
|
2
Enterococcus faecalis V583 Gene: EF3204: Putative metal chaperone, involved in Zn homeostasis, GTPase of COG0523 family Gene: EF0589: Putative metal chaperone, involved in Zn homeostasis, GTPase of COG0523 family |
Putative metal chaperone, involved in Zn homeostasis, GTPase of COG0523 family |
| EfaeDRAFT_0933 |
*
Enterococcus faecium DO Site: position = -69 score = 6.85637 sequence = CAAATCGTAATTGTTTCGATTTG Gene: EfaeDRAFT_0933: conserved hypothetical protein |
Gene: EF3205: conserved hypothetical protein |
conserved hypothetical protein |
| zinT |
*
Enterococcus faecium DO Site: position = -78 score = 6.71205 sequence = TAAAACGTAACTATTACGGTTTG Gene: EfaeDRAFT_2092: zinc-binding lipoprotein ZinT |
Gene: EF3206: zinc-binding lipoprotein ZinT |
Candidate zinc-binding lipoprotein ZinT |
| rpmF2 |
|
*2
Enterococcus faecalis V583 Site: position = -122 score = 7.29866 sequence = CAAAACGTAATCATTACGATTTG Gene: EF0544: LSU ribosomal protein L32p Gene: EF0586: LSU ribosomal protein L32p |
LSU ribosomal protein L32p |
| EF0587 |
|
2
Enterococcus faecalis V583 Gene: EF0587: hypothetical protein Gene: EF0545: hypothetical protein |
hypothetical protein |
| CRON 2. | |||
| znuA |
*
Enterococcus faecium DO Site: position = -150 score = 4.64733 sequence = CAACTCATCCATTTTACGATTTA Gene: EfaeDRAFT_1581: Zinc ABC transporter, periplasmic-binding protein ZnuA |
*
Enterococcus faecalis V583 Site: position = -52 score = 6.78841 sequence = CAAATCGTAAATATTACGGTTTA Gene: EF0055: Zinc ABC transporter, periplasmic-binding protein ZnuA |
Zinc ABC transporter, periplasmic-binding protein ZnuA |
| znuC |
*
Enterococcus faecium DO Site: position = -39 score = 4.3829 sequence = AAGAAAGTATCAATTAAGTTTTA Gene: EfaeDRAFT_1582: Zinc ABC transporter, ATP-binding protein ZnuC |
Gene: EF0056: Zinc ABC transporter, ATP-binding protein ZnuC |
Zinc ABC transporter, ATP-binding protein ZnuC |
| znuB |
Gene: EfaeDRAFT_1583: Zinc ABC transporter, inner membrane permease protein ZnuB |
Gene: EF0057: Zinc ABC transporter, inner membrane permease protein ZnuB |
Zinc ABC transporter, inner membrane permease protein ZnuB |
| CRON 3. | |||
| zur |
*
Enterococcus faecium DO Site: position = -35 score = 6.07968 sequence = TACTTCGTAATCATTTTGATTTG Gene: EfaeDRAFT_1775: Zinc homeostasis transcriptional regulator Zur, Fur family |
*
Enterococcus faecalis V583 Site: position = -46 score = 5.96081 sequence = TATTTCGTAATGATTCTGATTTA Gene: EF2417: Zinc homeostasis transcriptional regulator Zur, Fur family |
Zinc homeostasis transcriptional regulator Zur, Fur family |
Bluish color - the gene is in regulated operon. Different regulated operons are shown in different shades of blue.
Red color - the gene is in non-regulated operon.
Gray color - the orthologous gene is absent.
The star symbol - the TFBS is located in upstream region of this gene.
The number - the numeber of homologs (shown only if it is greater than one).
|
Regulated Genes | [ Tab delimited format ] | DOWNLOAD |
|
Regulatory Sites | [ FASTA format ] | DOWNLOAD |