Regulog AgaR - Clostridia-2
| Regulator type: | Transcription factor |
| Regulator family: | GntR/Others |
| Regulation mode: | |
| Biological process: | N-acetylgalactosamine utilization |
| Effector: | |
| Phylum: | Firmicutes |
| Visualization: | |
|
Allows to visualize regulog content in the context of metabolic pathways |
Member of regulog collections
- By taxonomy - Clostridia-2
- By TF family - GntR/Others
- By pathway - N-acetylgalactosamine utilization
| Genome | Genes | Operons |
|---|---|---|
| Clostridium bartlettii DSM 16795 | ||
| Clostridium difficile 630 | 5 | 3 |
| Clostridium hiranonis DSM 13275 |
| Genes | Function | |||
|---|---|---|---|---|
| CRON 1. | ||||
| agaS |
|
*
Clostridium difficile 630 Site: position = -246 score = 6.13651 sequence = TTAGTGGTAATTACCACTTT Site: position = -53 score = 5.09004 sequence = AAAGTGGGTATAACCTCATT Gene: CD3449: Galactosamine-6-phosphate isomerase (EC 5.3.1.-) |
|
Galactosamine-6-phosphate isomerase (EC 5.3.1.-) |
| agaY |
|
Gene: CD3448: Tagatose 1,6-diphosphate aldolase (EC 4.1.2.40) |
|
Tagatose 1,6-diphosphate aldolase (EC 4.1.2.40) |
| CRON 2. | ||||
| agaR |
|
*
Clostridium difficile 630 Site: position = -182 score = 5.93272 sequence = AAAGTGGTTATTACCAATTT Site: position = -37 score = 5.88023 sequence = ATTGTGGTAATAACCACTTA Gene: CD3452: Transcriptional regulator of N-Acetylgalactosamine utilization, GntR family |
|
Transcriptional regulator of N-Acetylgalactosamine utilization, GntR family |
| agaA |
|
Gene: CD3453: N-acetylglucosamine-6-phosphate deacetylase (EC 3.5.1.25) |
|
N-acetylglucosamine-6-phosphate deacetylase (EC 3.5.1.25) |
| CRON 3. | ||||
| agaZ |
|
*
Clostridium difficile 630 Site: position = -106 score = 5.93272 sequence = AAATTGGTAATAACCACTTT Site: position = -251 score = 5.88023 sequence = TAAGTGGTTATTACCACAAT Gene: CD3451: Tagatose-6-phosphate kinase (EC 2.7.1.144) |
|
Tagatose-6-phosphate kinase (EC 2.7.1.144) |
Bluish color - the gene is in regulated operon. Different regulated operons are shown in different shades of blue.
Red color - the gene is in non-regulated operon.
Gray color - the orthologous gene is absent.
The star symbol - the TFBS is located in upstream region of this gene.
The number - the numeber of homologs (shown only if it is greater than one).
|
Regulated Genes | [ Tab delimited format ] | DOWNLOAD |
|
Regulatory Sites | [ FASTA format ] | DOWNLOAD |