Regulog GulR - Xanthomonadales

Properties
Regulator type:	Transcription factor
Regulator family:	LysR
Regulation mode:
Biological process:	Galactarate utilization; Glucarate utilization
Effector:
Phylum:	Proteobacteria/Gamma
Visualization:
	Allows to visualize regulog content in the context of metabolic pathways

Built upon 2 sites [see more]

Member of regulog collections

By taxonomy - Xanthomonadales
By trascription factor - GulR
By TF family - LysR
By pathway - Galactarate utilization
By pathway - Glucarate utilization

Statistics of regulated genes
Genome	Genes	Operons
Stenotrophomonas maltophilia K279a
Xanthomonas axonopodis pv. citri str. 306
Xanthomonas campestris pv. campestris str. ATCC 33913	7	2
Xylella fastidiosa 9a5c

Clusters of co-Regulated Orthologous operoNs (CRONs)
Genes					Function

CRON 1.
gulR	Stenotrophomonas maltophilia K279a	Xanthomonas axonopodis pv. citri str. 306	* Xanthomonas campestris pv. campestris str. ATCC 33913 Site: position = -219 score = 5.63411 sequence = TTTGATACATAAATTGAATCGAT Gene: XCC3246: Predicted galactarate/glucarate utilization regulator, LysR family	Xylella fastidiosa 9a5c	Predicted galactarate/glucarate utilization regulator, LysR family

CRON 2.
kdgD	Stenotrophomonas maltophilia K279a	Xanthomonas axonopodis pv. citri str. 306	* Xanthomonas campestris pv. campestris str. ATCC 33913 Site: position = -101 score = 5.63411 sequence = ATCGATTCAATTTATGTATCAAA Gene: XCC3245: 5-dehydro-4-deoxyglucarate dehydratase (EC 4.2.1.41)	Xylella fastidiosa 9a5c	5-dehydro-4-deoxyglucarate dehydratase (EC 4.2.1.41)
kgsD	Stenotrophomonas maltophilia K279a	Xanthomonas axonopodis pv. citri str. 306	Xanthomonas campestris pv. campestris str. ATCC 33913 Gene: XCC3244: Alpha-ketoglutaric semialdehyde dehydrogenase (EC 1.2.1.26)	Xylella fastidiosa 9a5c	Alpha-ketoglutaric semialdehyde dehydrogenase (EC 1.2.1.26)
gudP	Stenotrophomonas maltophilia K279a	Xanthomonas axonopodis pv. citri str. 306	Xanthomonas campestris pv. campestris str. ATCC 33913 Gene: XCC3243: D-galactarate permease / D-glucarate permease	Xylella fastidiosa 9a5c	D-galactarate permease / D-glucarate permease
gudD	Stenotrophomonas maltophilia K279a	Xanthomonas axonopodis pv. citri str. 306	Xanthomonas campestris pv. campestris str. ATCC 33913 Gene: XCC3242: Glucarate dehydratase (EC 4.2.1.40)	Xylella fastidiosa 9a5c	Glucarate dehydratase (EC 4.2.1.40)
omp	Stenotrophomonas maltophilia K279a	Xanthomonas axonopodis pv. citri str. 306	Xanthomonas campestris pv. campestris str. ATCC 33913 Gene: XCC3241: Outer membrane porin protein 32 precursor	Xylella fastidiosa 9a5c	Outer membrane porin protein 32 precursor
garD	Stenotrophomonas maltophilia K279a	Xanthomonas axonopodis pv. citri str. 306	Xanthomonas campestris pv. campestris str. ATCC 33913 Gene: XCC3240: D-galactarate dehydratase (EC 4.2.1.42)	Xylella fastidiosa 9a5c	D-galactarate dehydratase (EC 4.2.1.42)

Bluish color - the gene is in regulated operon. Different regulated operons are shown in different shades of blue.

Red color - the gene is in non-regulated operon.

Gray color - the orthologous gene is absent.

The star symbol - the TFBS is located in upstream region of this gene.

The number - the numeber of homologs (shown only if it is greater than one).

Export
	Regulated Genes	[ Tab delimited format ]	DOWNLOAD
	Regulatory Sites	[ FASTA format ]	DOWNLOAD

Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes -- version 3.2 --

Regulog GulR - Xanthomonadales

Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes
-- version 3.2 --