Regulog GulR - Xanthomonadales
| Regulator type: | Transcription factor |
| Regulator family: | LysR |
| Regulation mode: | |
| Biological process: | Galactarate utilization; Glucarate utilization |
| Effector: | |
| Phylum: | Proteobacteria/Gamma |
| Visualization: | |
|
Allows to visualize regulog content in the context of metabolic pathways |
Member of regulog collections
- By taxonomy - Xanthomonadales
- By trascription factor - GulR
- By TF family - LysR
- By pathway - Galactarate utilization
- By pathway - Glucarate utilization
| Genome | Genes | Operons |
|---|---|---|
| Stenotrophomonas maltophilia K279a | ||
| Xanthomonas axonopodis pv. citri str. 306 | ||
| Xanthomonas campestris pv. campestris str. ATCC 33913 | 7 | 2 |
| Xylella fastidiosa 9a5c |
| Genes | Function | ||||
|---|---|---|---|---|---|
| CRON 1. | |||||
| gulR |
|
|
*
Xanthomonas campestris pv. campestris str. ATCC 33913 Site: position = -219 score = 5.63411 sequence = TTTGATACATAAATTGAATCGAT Gene: XCC3246: Predicted galactarate/glucarate utilization regulator, LysR family |
|
Predicted galactarate/glucarate utilization regulator, LysR family |
| CRON 2. | |||||
| kdgD |
|
|
*
Xanthomonas campestris pv. campestris str. ATCC 33913 Site: position = -101 score = 5.63411 sequence = ATCGATTCAATTTATGTATCAAA Gene: XCC3245: 5-dehydro-4-deoxyglucarate dehydratase (EC 4.2.1.41) |
|
5-dehydro-4-deoxyglucarate dehydratase (EC 4.2.1.41) |
| kgsD |
|
|
Gene: XCC3244: Alpha-ketoglutaric semialdehyde dehydrogenase (EC 1.2.1.26) |
|
Alpha-ketoglutaric semialdehyde dehydrogenase (EC 1.2.1.26) |
| gudP |
|
|
Gene: XCC3243: D-galactarate permease / D-glucarate permease |
|
D-galactarate permease / D-glucarate permease |
| gudD |
|
|
Gene: XCC3242: Glucarate dehydratase (EC 4.2.1.40) |
|
Glucarate dehydratase (EC 4.2.1.40) |
| omp |
|
|
Gene: XCC3241: Outer membrane porin protein 32 precursor |
|
Outer membrane porin protein 32 precursor |
| garD |
|
|
Gene: XCC3240: D-galactarate dehydratase (EC 4.2.1.42) |
|
D-galactarate dehydratase (EC 4.2.1.42) |
Bluish color - the gene is in regulated operon. Different regulated operons are shown in different shades of blue.
Red color - the gene is in non-regulated operon.
Gray color - the orthologous gene is absent.
The star symbol - the TFBS is located in upstream region of this gene.
The number - the numeber of homologs (shown only if it is greater than one).
|
Regulated Genes | [ Tab delimited format ] | DOWNLOAD |
|
Regulatory Sites | [ FASTA format ] | DOWNLOAD |