Regulog SdaR - Rhodospirillales
| Regulator type: | Transcription factor |
| Regulator family: | SdaR |
| Regulation mode: | activator |
| Biological process: | Glycerate utilization |
| Effector: | D-glycerate |
| Phylum: | Proteobacteria/Alpha |
| Visualization: | |
|
Allows to visualize regulog content in the context of metabolic pathways |
Member of regulog collections
- By taxonomy - Rhodospirillales
- By trascription factor - SdaR
- By TF family - SdaR
- By effector - D-glycerate
- By pathway - Glycerate utilization
| Genome | Genes | Operons |
|---|---|---|
| Rhodospirillum rubrum ATCC 11170 | ||
| Magnetospirillum magneticum AMB-1 | ||
| Magnetospirillum magnetotacticum MS-1 | ||
| Azospirillum sp. B510 | 2 | 1 |
| Rhodospirillum centenum SW | ||
| Gluconacetobacter diazotrophicus PAl 5 | 3 | 2 |
| Acetobacter pasteurianus IFO 3283-01 | ||
| Gluconobacter oxydans 621H | ||
| Granulibacter bethesdensis CGDNIH1 |
| Genes | Function | |||||||||
|---|---|---|---|---|---|---|---|---|---|---|
| CRON 1. | ||||||||||
| garK |
|
|
|
*
Azospirillum sp. B510 Site: position = -134 score = 5.68486 sequence = TTTTGGAGATTTGCACAAAG Gene: AZL_a08400: Glycerate kinase (EC 2.7.1.31) |
|
Gene: Gdia_1380: Glycerate kinase (EC 2.7.1.31) |
|
|
|
Glycerate kinase (EC 2.7.1.31) |
| sdaR |
|
|
|
Gene: AZL_a08410: Glycerate utilization transcriptional regulator SdaR, SdaR family |
|
*
Gluconacetobacter diazotrophicus PAl 5 Site: position = -73 score = 6.47826 sequence = CTTTGTGCATCTGCACTAAA Gene: Gdia_1382: Glycerate utilization transcriptional regulator SdaR, SdaR family |
|
|
|
Glycerate utilization transcriptional regulator SdaR, SdaR family |
| grtT |
|
|
|
|
|
*
Gluconacetobacter diazotrophicus PAl 5 Site: position = -128 score = 6.47826 sequence = TTTAGTGCAGATGCACAAAG Gene: Gdia_1381: Predicted D-glycerate transporter, MFS family |
|
|
|
Predicted D-glycerate transporter, MFS family |
Bluish color - the gene is in regulated operon. Different regulated operons are shown in different shades of blue.
Red color - the gene is in non-regulated operon.
Gray color - the orthologous gene is absent.
The star symbol - the TFBS is located in upstream region of this gene.
The number - the numeber of homologs (shown only if it is greater than one).
|
Regulated Genes | [ Tab delimited format ] | DOWNLOAD |
|
Regulatory Sites | [ FASTA format ] | DOWNLOAD |