Regulog HrcA - Chlorobiales
| Regulator type: | Transcription factor |
| Regulator family: | HrcA |
| Regulation mode: | repressor |
| Biological process: | Heat shock response |
| Effector: | Heat shock |
| Phylum: | Chlorobi |
| Visualization: | |
|
Allows to visualize regulog content in the context of metabolic pathways |
Member of regulog collections
- By trascription factor - HrcA
- By taxonomy - Chlorobiales
- By TF family - HrcA
- By effector - Heat shock
- By pathway - Heat shock response
| Genome | Genes | Operons |
|---|---|---|
| Chlorobaculum parvum NCIB 8327 | 2 | 1 |
| Chlorobium chlorochromatii CaD3 | 2 | 1 |
| Chlorobium ferrooxidans DSM 13031 | ||
| Chlorobium limicola DSM 245 | 2 | 1 |
| Chlorobium phaeobacteroides BS1 | 2 | 1 |
| Chlorobium phaeobacteroides DSM 266 | 2 | 1 |
| Chloroherpeton thalassium ATCC 35110 | 2 | 1 |
| Pelodictyon luteolum DSM 273 | 2 | 1 |
| Pelodictyon phaeoclathratiforme BU-1 | 2 | 1 |
| Prosthecochloris aestuarii DSM 271 | 2 | 1 |
| Prosthecochloris vibrioformis DSM 265 | 2 | 1 |
| Genes | Function | |||||||||||
|---|---|---|---|---|---|---|---|---|---|---|---|---|
| CRON 1. | ||||||||||||
| groS |
*
Chlorobaculum parvum NCIB 8327 Site: position = -115 score = 7.66838 sequence = TTAGCACTCTCGTTAGGTGAGTGCTAA Gene: Cpar_1367: Heat shock protein 60 family co-chaperone GroES |
*
Chlorobium chlorochromatii CaD3 Site: position = -101 score = 7.2912 sequence = TTAGCACTCTCACCTCGAGAGTGCTAA Gene: Cag_1305: Heat shock protein 60 family co-chaperone GroES |
|
*
Chlorobium limicola DSM 245 Site: position = -96 score = 7.24959 sequence = TTAGCACTCTTGTCCATTGAGTGCTAA Gene: Clim_0497: Heat shock protein 60 family co-chaperone GroES |
*
Chlorobium phaeobacteroides BS1 Site: position = -107 score = 7.40848 sequence = TTAGCACTCGGTGTTGTAGAGTGCTAA Gene: Cphamn1_0782: Heat shock protein 60 family co-chaperone GroES |
*
Chlorobium phaeobacteroides DSM 266 Site: position = -93 score = 7.33565 sequence = TTAGCACTCTTCCGTTGAGAGTGCTAA Gene: Cpha266_1937: Heat shock protein 60 family co-chaperone GroES |
*
Chloroherpeton thalassium ATCC 35110 Site: position = -188 score = 7.8291 sequence = TTAGCACTCTATTAAGGAGAGTGCTAA Site: position = -113 score = 7.8291 sequence = TTAGCACTCTATTAAGGAGAGTGCTAA Gene: Ctha_1617: Heat shock protein 60 family co-chaperone GroES |
*
Pelodictyon luteolum DSM 273 Site: position = -95 score = 7.42042 sequence = TTAGCACTCGGCGTTGTTGAGTGCTAA Gene: Plut_0541: Heat shock protein 60 family co-chaperone GroES |
*
Pelodictyon phaeoclathratiforme BU-1 Site: position = -97 score = 7.58327 sequence = TTAGCACTCGACTCTGTTGAGTGCTAA Gene: Ppha_0833: Heat shock protein 60 family co-chaperone GroES |
*
Prosthecochloris aestuarii DSM 271 Site: position = -106 score = 7.69854 sequence = TTAGCACTCAACAAAAGAGAGTGCTAA Gene: Paes_0679: Heat shock protein 60 family co-chaperone GroES |
*
Prosthecochloris vibrioformis DSM 265 Site: position = -100 score = 7.11954 sequence = TTAGCACTCATCGTTTCCGAGTGCTAA Gene: Cvib_0585: Heat shock protein 60 family co-chaperone GroES |
Heat shock protein 60 family co-chaperone GroES |
| groL |
Gene: Cpar_1366: Heat shock protein 60 family chaperone GroEL |
Gene: Cag_1306: Heat shock protein 60 family chaperone GroEL |
|
Gene: Clim_0498: Heat shock protein 60 family chaperone GroEL |
Gene: Cphamn1_0783: Heat shock protein 60 family chaperone GroEL |
Gene: Cpha266_1936: Heat shock protein 60 family chaperone GroEL |
Gene: Ctha_1618: Heat shock protein 60 family chaperone GroEL |
Gene: Plut_0542: Heat shock protein 60 family chaperone GroEL |
Gene: Ppha_0834: Heat shock protein 60 family chaperone GroEL |
Gene: Paes_0680: Heat shock protein 60 family chaperone GroEL |
Gene: Cvib_0586: Heat shock protein 60 family chaperone GroEL |
Heat shock protein 60 family chaperone GroEL |
Bluish color - the gene is in regulated operon. Different regulated operons are shown in different shades of blue.
Red color - the gene is in non-regulated operon.
Gray color - the orthologous gene is absent.
The star symbol - the TFBS is located in upstream region of this gene.
The number - the numeber of homologs (shown only if it is greater than one).
|
Regulated Genes | [ Tab delimited format ] | DOWNLOAD |
|
Regulatory Sites | [ FASTA format ] | DOWNLOAD |