Regulog HrcA - Alcaligenaceae
| Regulator type: | Transcription factor |
| Regulator family: | HrcA |
| Regulation mode: | repressor |
| Biological process: | Heat shock response |
| Effector: | Heat shock |
| Phylum: | Proteobacteria/beta |
| Visualization: | |
|
Allows to visualize regulog content in the context of metabolic pathways |
Member of regulog collections
- By trascription factor - HrcA
- By taxonomy - Alcaligenaceae
- By TF family - HrcA
- By effector - Heat shock
- By pathway - Heat shock response
| Genome | Genes | Operons |
|---|---|---|
| Bordetella avium 197N | 3 | 2 |
| Bordetella bronchiseptica RB50 | 3 | 2 |
| Bordetella petrii DSM 12804 | 3 | 2 |
| Genes | Function | |||
|---|---|---|---|---|
| CRON 1. | ||||
| rpoH |
*
Bordetella avium 197N Site: position = -37 score = 7.167 sequence = TTAGCACTCAACCATTTGGAGTGCTAA Gene: BAV3285: Heat shock response RNA polymerase sigma factor RpoH (Sigma 32) |
*
Bordetella bronchiseptica RB50 Site: position = -36 score = 7.43946 sequence = TTAGCACTCGATTGCGTGGAGTGCTAA Gene: BB4835: Heat shock response RNA polymerase sigma factor RpoH (Sigma 32) |
*
Bordetella petrii DSM 12804 Site: position = -72 score = 7.11397 sequence = TTAGCACTCGCACATAGAGAGTGCTAA Gene: Bpet0159: Heat shock response RNA polymerase sigma factor RpoH (Sigma 32) |
Heat shock response RNA polymerase sigma factor RpoH (Sigma 32) |
| CRON 2. | ||||
| groS |
*
Bordetella avium 197N Site: position = -85 score = 7.87453 sequence = TTAGCACTCGTCGCCGGTGAGTGCTAA Gene: BAV0580: Heat shock protein 60 family co-chaperone GroES |
*
Bordetella bronchiseptica RB50 Site: position = -91 score = 7.87453 sequence = TTAGCACTCGTCGCCGGTGAGTGCTAA Gene: BB0963: Heat shock protein 60 family co-chaperone GroES |
*
Bordetella petrii DSM 12804 Site: position = -90 score = 7.90512 sequence = TTAGCACTCGCTGCCGGTGAGTGCTAA Gene: Bpet3931: Heat shock protein 60 family co-chaperone GroES |
Heat shock protein 60 family co-chaperone GroES |
| groL |
Gene: BAV0579: Heat shock protein 60 family chaperone GroEL |
Gene: BB0962: Heat shock protein 60 family chaperone GroEL |
Gene: Bpet3932: Heat shock protein 60 family chaperone GroEL |
Heat shock protein 60 family chaperone GroEL |
Bluish color - the gene is in regulated operon. Different regulated operons are shown in different shades of blue.
Red color - the gene is in non-regulated operon.
Gray color - the orthologous gene is absent.
The star symbol - the TFBS is located in upstream region of this gene.
The number - the numeber of homologs (shown only if it is greater than one).
|
Regulated Genes | [ Tab delimited format ] | DOWNLOAD |
|
Regulatory Sites | [ FASTA format ] | DOWNLOAD |