Regulog EbgR - Psychromonadaceae/Aeromonadales
| Regulator type: | Transcription factor |
| Regulator family: | LacI |
| Regulation mode: | repressor |
| Biological process: | Galactosides utilization |
| Effector: | Beta-galactosides |
| Phylum: | Proteobacteria/gamma |
| Visualization: | |
|
Allows to visualize regulog content in the context of metabolic pathways |
Member of regulog collections
- By taxonomy - Psychromonadaceae/Aeromonadales
- By TF family - LacI
- By effector - Beta-galactosides
- By pathway - Galactosides utilization
| Genome | Genes | Operons |
|---|---|---|
| Tolumonas auensis DSM 9187 | ||
| Aeromonas salmonicida subsp. salmonicida A449 | ||
| Aeromonas hydrophila subsp. hydrophila ATCC 7966 | 4 | 2 |
| Moritella sp. PE36 | ||
| Psychromonas sp. CNPT3 | 1 | 1 |
| Psychromonas ingrahamii 37 |
| Genes | Function | ||||||
|---|---|---|---|---|---|---|---|
| CRON 1. | |||||||
| ebgA |
|
|
*
Aeromonas hydrophila subsp. hydrophila ATCC 7966 Site: position = -326 score = 4.94468 sequence = GCTGATTTTAGTAAAATAATC Site: position = -65 score = 4.7576 sequence = CTGATATTTAGTAAATGTTTA Gene: AHA_0205: Evolved beta-D-galactosidase, alpha subunit |
|
|
|
Evolved beta-D-galactosidase, alpha subunit |
| ebgC |
|
|
Gene: AHA_0206: Evolved beta-D-galactosidase, beta subunit |
|
|
|
Evolved beta-D-galactosidase, beta subunit |
| ygjI |
|
|
Gene: AHA_0207: predicted beta-galactoside transporter, AAP family |
|
Gene: PCNPT3_06101: predicted beta-galactoside transporter, AAP family |
|
predicted beta-galactoside transporter, AAP family |
| CRON 2. | |||||||
| ebgR |
|
|
*
Aeromonas hydrophila subsp. hydrophila ATCC 7966 Site: position = -89 score = 4.90755 sequence = GTTTCTTTTAGTAAAAATGCT Gene: AHA_0204: Evolved beta-D-galactosidase transcriptional repressor, LacI family |
|
*
Psychromonas sp. CNPT3 Site: position = -87 score = 5.38077 sequence = CTAAGTTTTAGTAAAAAACAT Site: position = -49 score = 4.65635 sequence = AAATAATTCAGTAATATATAC Gene: PCNPT3_06111: Evolved beta-D-galactosidase transcriptional repressor, LacI family |
|
Evolved beta-D-galactosidase transcriptional repressor, LacI family |
Bluish color - the gene is in regulated operon. Different regulated operons are shown in different shades of blue.
Red color - the gene is in non-regulated operon.
Gray color - the orthologous gene is absent.
The star symbol - the TFBS is located in upstream region of this gene.
The number - the numeber of homologs (shown only if it is greater than one).
|
Regulated Genes | [ Tab delimited format ] | DOWNLOAD |
|
Regulatory Sites | [ FASTA format ] | DOWNLOAD |