Orthologous regulated operons containing ebgC gene

Properties
Regulog:	EbgR - Psychromonadaceae/Aeromonadales
Regulator type:	Transcription factor
Regulator family:	LacI
Regulation mode:	repressor
Biological process:	Galactosides utilization
Effector:	Beta-galactosides
Phylum:	Proteobacteria/gamma

Built upon 5 sites [see more]

Orthologous operons
Operon	Position	Score	Sequence	Locus Tag of the First Gene
Aeromonas hydrophila subsp. hydrophila ATCC 7966
Position: -326 Score: 4.94468 Sequence: GCTGATTTTAGTAAAATAATC Position: -65 Score: 4.7576 Sequence: CTGATATTTAGTAAATGTTTA Locus tag: AHA_0205 Name: ebgA Funciton: Evolved beta-D-galactosidase, alpha subunit Locus tag: AHA_0206 Name: ebgC Funciton: Evolved beta-D-galactosidase, beta subunit Locus tag: AHA_0207 Name: ygjI Funciton: predicted beta-galactoside transporter, AAP family
ebgA-ebgC-ygjI	-326	4.9	GCTGATTTTAGTAAAATAATC	AHA_0205
	-65	4.8	CTGATATTTAGTAAATGTTTA

Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes -- version 3.2 --