Regulog SgaR - Pasteurellales
| Regulator type: | Transcription factor |
| Regulator family: | LacI |
| Regulation mode: | repressor |
| Biological process: | Ascorbate utilization |
| Effector: | Ascorbate-6-phosphate |
| Phylum: | Proteobacteria/gamma |
| Visualization: | |
|
Allows to visualize regulog content in the context of metabolic pathways |
Member of regulog collections
- By taxonomy - Pasteurellales
- By TF family - LacI
- By effector - Ascorbate-6-phosphate
- By pathway - Ascorbate utilization
| Genome | Genes | Operons |
|---|---|---|
| Actinobacillus pleuropneumoniae serovar 7 str. AP76 | ||
| Actinobacillus succinogenes 130Z | ||
| Aggregatibacter aphrophilus NJ8700 | ||
| Haemophilus ducreyi 35000HP | ||
| Haemophilus influenzae Rd KW20 | ||
| Haemophilus parasuis SH0165 | ||
| Haemophilus somnus 2336 | ||
| Mannheimia succiniciproducens MBEL55E | 4 | 2 |
| Pasteurella multocida subsp. multocida str. Pm70 |
| Genes | Function | |||||||||
|---|---|---|---|---|---|---|---|---|---|---|
| CRON 1. | ||||||||||
| sgaR |
|
|
|
|
|
|
|
*
Mannheimia succiniciproducens MBEL55E Site: position = -123 score = 6.24637 sequence = CAATGATAGCGTTATCAATA Site: position = -89 score = 5.86991 sequence = TTGTGATAGCGGTAACATTT Gene: MS0148: Ascorbate utilization transcriptional regulator SgaR, LacI family |
|
Ascorbate utilization transcriptional regulator SgaR, LacI family |
| CRON 2. | ||||||||||
| sgaA |
|
|
|
|
|
|
|
*
Mannheimia succiniciproducens MBEL55E Site: position = -65 score = 5.86991 sequence = AAATGTTACCGCTATCACAA Site: position = -31 score = 6.24637 sequence = TATTGATAACGCTATCATTG Gene: MS0149: Ascorbate-specific PTS system, EIIA component (EC 2.7.1.-) |
|
Ascorbate-specific PTS system, EIIA component (EC 2.7.1.-) |
| sgaB |
Gene: APP7_1775: Ascorbate-specific PTS system, EIIB component (EC 2.7.1.69) |
Gene: Asuc_0509: Ascorbate-specific PTS system, EIIB component (EC 2.7.1.69) |
Gene: NT05HA_1126: Ascorbate-specific PTS system, EIIB component (EC 2.7.1.69) |
|
|
|
|
Gene: MS0150: Ascorbate-specific PTS system, EIIB component (EC 2.7.1.69) |
|
Ascorbate-specific PTS system, EIIB component (EC 2.7.1.69) |
| sgaT |
Gene: APP7_1774: Ascorbate-specific PTS system, EIIC component |
Gene: Asuc_0508: Ascorbate-specific PTS system, EIIC component |
|
|
|
|
|
Gene: MS0151: Ascorbate-specific PTS system, EIIC component |
|
Ascorbate-specific PTS system, EIIC component |
Bluish color - the gene is in regulated operon. Different regulated operons are shown in different shades of blue.
Red color - the gene is in non-regulated operon.
Gray color - the orthologous gene is absent.
The star symbol - the TFBS is located in upstream region of this gene.
The number - the numeber of homologs (shown only if it is greater than one).
|
Regulated Genes | [ Tab delimited format ] | DOWNLOAD |
|
Regulatory Sites | [ FASTA format ] | DOWNLOAD |