Regulog VP2396 - Vibrionales
| Regulator type: | Transcription factor |
| Regulator family: | LacI |
| Regulation mode: | repressor |
| Biological process: | Galactosides utilization |
| Effector: | |
| Phylum: | Proteobacteria/gamma |
| Visualization: | |
|
Allows to visualize regulog content in the context of metabolic pathways |
Member of regulog collections
- By taxonomy - Vibrionales
- By TF family - LacI
- By pathway - Galactosides utilization
| Genome | Genes | Operons |
|---|---|---|
| Photobacterium profundum SS9 | ||
| Vibrio angustum S14 | ||
| Vibrio cholerae O1 biovar eltor str. N16961 | ||
| Vibrio fischeri ES114 | ||
| Vibrio harveyi ATCC BAA-1116 | ||
| Vibrio parahaemolyticus RIMD 2210633 | 3 | 2 |
| Vibrio salmonicida LFI1238 | ||
| Vibrio shilonii AK1 | 3 | 2 |
| Vibrio splendidus LGP32 | ||
| Vibrio vulnificus CMCP6 |
| Genes | Function | ||||||||||
|---|---|---|---|---|---|---|---|---|---|---|---|
| CRON 1. | |||||||||||
| GH5 |
|
|
|
|
|
*
Vibrio parahaemolyticus RIMD 2210633 Site: position = -63 score = 6.07061 sequence = AAATTATTAATTAATATATT Site: position = -51 score = 6.35458 sequence = AATATATTAGCTAATATTAT Site: position = -38 score = 5.87878 sequence = ATATTATTAGTTAATAATTT Site: position = -183 score = 5.02844 sequence = AAGATATTAGCTAAAGATTA Gene: VP2395: Glycoside hydrolase, family 5 |
|
*
Vibrio shilonii AK1 Site: position = -71 score = 5.74967 sequence = AAATTATTAGTAAATATATT Site: position = -46 score = 5.08585 sequence = ATATTATTAGTTAAGTTATT Site: position = -59 score = 6.35458 sequence = AATATATTAGCTAATATTAT Gene: VSAK1_10703: Glycoside hydrolase, family 5 |
|
|
Glycoside hydrolase, family 5 |
| VP2394 |
|
|
|
|
|
Gene: VP2394: Lactose and galactose permease, GPH translocator family |
|
Gene: VSAK1_10698: Lactose and galactose permease, GPH translocator family |
|
|
Lactose and galactose permease, GPH translocator family |
| CRON 2. | |||||||||||
| VP2396 |
|
|
|
|
|
*
Vibrio parahaemolyticus RIMD 2210633 Site: position = -169 score = 6.07061 sequence = AATATATTAATTAATAATTT Site: position = -49 score = 5.02844 sequence = TAATCTTTAGCTAATATCTT Site: position = -181 score = 6.35458 sequence = ATAATATTAGCTAATATATT Site: position = -194 score = 5.87878 sequence = AAATTATTAACTAATAATAT Gene: VP2396: Transcriptional regulator, LacI family |
|
*
Vibrio shilonii AK1 Site: position = -192 score = 5.08585 sequence = AATAACTTAACTAATAATAT Site: position = -167 score = 5.74967 sequence = AATATATTTACTAATAATTT Site: position = -179 score = 6.35458 sequence = ATAATATTAGCTAATATATT Gene: VSAK1_10708: Transcriptional regulator, LacI family |
|
|
Transcriptional regulator, LacI family |
Bluish color - the gene is in regulated operon. Different regulated operons are shown in different shades of blue.
Red color - the gene is in non-regulated operon.
Gray color - the orthologous gene is absent.
The star symbol - the TFBS is located in upstream region of this gene.
The number - the numeber of homologs (shown only if it is greater than one).
|
Regulated Genes | [ Tab delimited format ] | DOWNLOAD |
|
Regulatory Sites | [ FASTA format ] | DOWNLOAD |