Regulog CelR2 - Vibrionales
| Regulator type: | Transcription factor |
| Regulator family: | LacI |
| Regulation mode: | repressor |
| Biological process: | Cellobiose utilization |
| Effector: | Cellobiose-6-phosphate |
| Phylum: | Proteobacteria/gamma |
| Visualization: | |
|
Allows to visualize regulog content in the context of metabolic pathways |
Member of regulog collections
- By taxonomy - Vibrionales
- By TF family - LacI
- By effector - Cellobiose-6-phosphate
- By pathway - Cellobiose utilization
| Genome | Genes | Operons |
|---|---|---|
| Photobacterium profundum SS9 | ||
| Vibrio angustum S14 | ||
| Vibrio cholerae O1 biovar eltor str. N16961 | 2 | 1 |
| Vibrio fischeri ES114 | 6 | 1 |
| Vibrio harveyi ATCC BAA-1116 | ||
| Vibrio parahaemolyticus RIMD 2210633 | ||
| Vibrio salmonicida LFI1238 | 6 | 1 |
| Vibrio shilonii AK1 | ||
| Vibrio splendidus LGP32 | ||
| Vibrio vulnificus CMCP6 |
| Genes | Function | ||||||||||
|---|---|---|---|---|---|---|---|---|---|---|---|
| CRON 1. | |||||||||||
| celF |
|
|
|
*
Vibrio fischeri ES114 Site: position = -85 score = 6.25556 sequence = ATATGTAACCGGTTACTGAA Site: position = -72 score = 6.21413 sequence = TACTGAAACCGGTTACATTT Gene: VF_0603: PTS system, cellobiose-specific IIC component (EC 2.7.1.69) |
|
|
*
Vibrio salmonicida LFI1238 Site: position = -71 score = 6.1202 sequence = TACTGAAACCGGTTACATTG Site: position = -84 score = 5.70852 sequence = GCGTGTAACCGGTTACTGAA Gene: VSAL_I0703: PTS system, cellobiose-specific IIC component (EC 2.7.1.69) |
|
|
|
PTS system, cellobiose-specific IIC component (EC 2.7.1.69) |
| celE |
|
|
|
Gene: VF_0604: PTS system, cellobiose-specific IIB component (EC 2.7.1.69) |
|
|
Gene: VSAL_I0704: PTS system, cellobiose-specific IIB component (EC 2.7.1.69) |
|
|
|
PTS system, cellobiose-specific IIB component (EC 2.7.1.69) |
| bglA |
|
|
*
Vibrio cholerae O1 biovar eltor str. N16961 Site: position = -97 score = 5.35814 sequence = TTCAGAAACTGGTTACATTG Site: position = -110 score = 6.56752 sequence = TTTTGTAACCGGTTTCAGAA Gene: VC1558: 6-phospho-beta-glucosidase (EC 3.2.1.86) |
Gene: VF_0605: 6-phospho-beta-glucosidase (EC 3.2.1.86) |
|
|
Gene: VSAL_I0705: 6-phospho-beta-glucosidase (EC 3.2.1.86) |
|
|
|
6-phospho-beta-glucosidase (EC 3.2.1.86) |
| glk |
|
|
|
Gene: VF_0606: Glucokinase, ROK family (EC 2.7.1.2) |
|
|
Gene: VSAL_I0706: Glucokinase, ROK family (EC 2.7.1.2) |
|
|
|
Glucokinase, ROK family (EC 2.7.1.2) |
| celG |
|
|
|
Gene: VF_0607: PTS system, cellobiose-specific IIA component (EC 2.7.1.69) |
|
|
Gene: VSAL_I0707: PTS system, cellobiose-specific IIA component (EC 2.7.1.69) |
|
|
|
PTS system, cellobiose-specific IIA component (EC 2.7.1.69) |
| celR2 |
|
|
Gene: VC1557: Transcriptional regulator for cellobiose utilization, LacI family |
Gene: VF_0608: Transcriptional regulator for cellobiose utilization, LacI family |
|
|
Gene: VSAL_I0708: Transcriptional regulator for cellobiose utilization, LacI family |
|
|
|
Transcriptional regulator for cellobiose utilization, LacI family |
Bluish color - the gene is in regulated operon. Different regulated operons are shown in different shades of blue.
Red color - the gene is in non-regulated operon.
Gray color - the orthologous gene is absent.
The star symbol - the TFBS is located in upstream region of this gene.
The number - the numeber of homologs (shown only if it is greater than one).
|
Regulated Genes | [ Tab delimited format ] | DOWNLOAD |
|
Regulatory Sites | [ FASTA format ] | DOWNLOAD |